Exoc3l4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Exoc3l4^em1(IMPC)J
• Name: exocyst complex component 3-like 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6294137
• Synonyms: Exoc3l4^-
• Gene: Exoc3l4 Location: Chr12:111383864-111398114 bp, + strand Genetic Position: Chr12, 60.98 cM, cytoband F2
• Alliance: Exoc3l4^em1(IMPC)J page
• IMPC: Exoc3l4 gene page

By E10.5 most Exoc3l4^em1(IMPC)J/Exoc3l4^em1(IMPC)J (Exoc3l4-/-) embryos are smaller, some are developmentally delayed, about half have abnormal hearts with some also having pericardial edema while others have cardiac edema. Embryos start dying around E11.5.

Show the 3 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

Allele Type: Endonuclease-mediated (Null/knockout) Mutation: Intragenic deletion Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGAGTTGTTAGGACCCAGG and AAGAGTCTAGATCACTCCAC, which resulted in a 592 bp deletion beginning at Chromosome 12 position 111,425,123 bp and ending after 111,425,714 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000116352 and ENSMUSE00000116361 (exons 5 and 6) and 357 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 352 and early truncation 1 amino acid later. (J:188991) Inheritance: Not Specified

Strategy for the generation of the Exoc3l4^em1(IMPC)J allele.

Expression

In Mice Carrying this Mutation:	30 assay results
In Structures Affected by this Mutation:	4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Exoc3l4 Mutation: 23 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)