About   Help   FAQ
Exoc3l4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Exoc3l4em1(IMPC)J
Name: exocyst complex component 3-like 4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6294137
Synonyms: Exoc3l4-
Gene: Exoc3l4  Location: Chr12:111383864-111398114 bp, + strand  Genetic Position: Chr12, 60.98 cM, cytoband F2
Alliance: Exoc3l4em1(IMPC)J page
IMPC: Exoc3l4 gene page
By E10.5 most Exoc3l4em1(IMPC)J/Exoc3l4em1(IMPC)J (Exoc3l4-/-) embryos are smaller, some are developmentally delayed, about half have abnormal hearts with some also having pericardial edema while others have cardiac edema. Embryos start dying around E11.5.

Show the 3 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGAGTTGTTAGGACCCAGG and AAGAGTCTAGATCACTCCAC, which resulted in a 592 bp deletion beginning at Chromosome 12 position 111,425,123 bp and ending after 111,425,714 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000116352 and ENSMUSE00000116361 (exons 5 and 6) and 357 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 352 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Strategy for the generation of the Exoc3l4em1(IMPC)J allele.
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 30 assay results
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Exoc3l4 Mutation:  23 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory