Atp1b1^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Atp1b1^em1(IMPC)Mbp
• Name: ATPase, Na+/K+ transporting, beta 1 polypeptide; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:7425530
• Synonyms: Atp1b1^-
• Gene: Atp1b1 Location: Chr1:164264678-164285924 bp, - strand Genetic Position: Chr1, 71.75 cM
• Alliance: Atp1b1^em1(IMPC)Mbp page
• IMPC: Atp1b1 gene page

Atp1b1^em1(IMPC)Mbp/Atp1b1^em1(IMPC)Mbp embryos show growth retardation, abnormal embryo turning at E9.5, abnormal head shape, a slight kink in their caudal neural tube and defect in cranial neural tube closure, abnormal heart, and half show branchial arch defects.

Show the 4 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

Allele Type: Endonuclease-mediated (Null/knockout) Mutation: Intragenic deletion Mutation details: This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences GTGCGGGGAACGCCTGCGTT and TCCGTTAGGACTGTAACACC that targeted exon(s) ENSMUSE00000160672.5 ENSMUSE00000536236.4. This resulted in deletion(s) of 99 bp (location: Chr1:164268848-164268946; GRCm39), 2018 bp (location: Chr1:164268974-164270991; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794) Inheritance: Not Specified

Strategy for the generation of the Atp1b1^em1(IMPC)Mbp allele.

Expression

In Mice Carrying this Mutation:	42 assay results
In Structures Affected by this Mutation:	14 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Atp1b1 Mutation: 20 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 6 reference(s)