Atp1b1em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Atp1b1em1(IMPC)Mbp |
| Name: |
ATPase, Na+/K+ transporting, beta 1 polypeptide; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis |
| MGI ID: |
MGI:7425530 |
| Synonyms: |
Atp1b1- |
| Gene: |
Atp1b1 Location: Chr1:164264678-164285924 bp, - strand Genetic Position: Chr1, 71.75 cM
|
| Alliance: |
Atp1b1em1(IMPC)Mbp page
|
| IMPC: |
Atp1b1 gene page |
|
Atp1b1em1(IMPC)Mbp/Atp1b1em1(IMPC)Mbp embryos show growth retardation, abnormal embryo turning at E9.5, abnormal head shape, a slight kink in their caudal neural tube and defect in cranial neural tube closure, abnormal heart, and half show branchial arch defects.
Show the 4 phenotype image(s) involving this allele.
|
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at University of California, Davis using Cas9 and guides with spacer sequences GTGCGGGGAACGCCTGCGTT and TCCGTTAGGACTGTAACACC that targeted exon(s) ENSMUSE00000160672.5 ENSMUSE00000536236.4 ENSMUSE00001847404.1 ENSMUSE00002134622.1. This resulted in deletion(s) of 99 bp (location: Chr1:164268848-164268946; GRCm39), 2018 bp (location: Chr1:164268974-164270991; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
Strategy for the generation of the Atp1b1em1(IMPC)Mbp allele. |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
6 reference(s) |
|