Gcn1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Gcn1em1(IMPC)J |
| Name: |
GCN1 activator of EIF2AK4; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6477990 |
| Synonyms: |
Gcn1- |
| Gene: |
Gcn1 Location: Chr5:115703313-115760713 bp, + strand Genetic Position: Chr5, 56.1 cM
|
| Alliance: |
Gcn1em1(IMPC)J page
|
| IMPC: |
Gcn1 gene page |
|
Gcn1em1(IMPC)J/Gcn1em1(IMPC)J embryos are small and growth delayed. E9.5 embryos remain unturned or display incomplete turning, show abnormal yolk sac vascularization, and abnormal head shape and cranial neural tube closure. E10.5 embryos display turning defects, severe cardiac defects, open cranial neural tube and more than 50% lethality.
Show the 5 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTACAGAGCAGGGCTCAGCA and GCTGGTGTAGAGCCACTGGT, which resulted in a 1611 bp deletion beginning at Chromosome 5 position 115,574,333 bp and ending after 115,575,943 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001249622, ENSMUSE00001219534(exons 3 and 4) and 1415 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 40 and early truncation 11 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
Strategy for the generation of the Gcn1em1(IMPC)J allele. |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|