Gcn1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gcn1^em1(IMPC)J
• Name: GCN1 activator of EIF2AK4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6477990
• Synonyms: Gcn1^-
• Gene: Gcn1 Location: Chr5:115703313-115760713 bp, + strand Genetic Position: Chr5, 56.1 cM
• Alliance: Gcn1^em1(IMPC)J page
• IMPC: Gcn1 gene page

Gcn1^em1(IMPC)J/Gcn1^em1(IMPC)J embryos are small and growth delayed. E9.5 embryos remain unturned or display incomplete turning, show abnormal yolk sac vascularization, and abnormal head shape and cranial neural tube closure. E10.5 embryos display turning defects, severe cardiac defects, open cranial neural tube and more than 50% lethality.

Show the 5 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

Allele Type: Endonuclease-mediated (Null/knockout) Mutation: Deletion Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences CTACAGAGCAGGGCTCAGCA and GCTGGTGTAGAGCCACTGGT that targeted exon(s) ENSMUSE00001219534.2 ENSMUSE00001249622.2. This resulted in deletion(s) of 1611 bp (location: Chr5:115712392-115714002; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794) Inheritance: Not Specified

Strategy for the generation of the Gcn1^em1(IMPC)J allele.

Expression

In Mice Carrying this Mutation:	44 assay results
In Structures Affected by this Mutation:	5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gcn1 Mutation: 137 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 6 reference(s)