Chp1^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Chp1^em1(IMPC)Tcp
• Name: calcineurin-like EF hand protein 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6388376
• Synonyms: Chp1^-
• Gene: Chp1 Location: Chr2:119378178-119417508 bp, + strand Genetic Position: Chr2, 59.97 cM
• Alliance: Chp1^em1(IMPC)Tcp page
• IMPC: Chp1 gene page

Chp1^em1(IMPC)Tcp/Chp1^em1(IMPC)Tcp embryos are developmentally delayed, show abnormal allantois and fragile allantois attachment, impaired embryo turning, abnormal head shape with failed cranial neural tube closure, abnormal heart development, and yolk sac defects.

Show the 5 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

Allele Type: Endonuclease-mediated (Null/knockout) Mutation: Intragenic deletion Mutation details: This allele from project TCPR1506 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GAACGCCATGTCAATCACGG targeting the 5' side and GATTGGGCAATAGTCCAACC targeting the 3' side of a critical region. This resulted in a 969-bp deletion Chr2: 119571727-119572695 (GRCm38). (J:265051) Inheritance: Not Specified

Strategy for the generation of the Chp1^em1(IMPC)Tcp allele.

Expression

In Mice Carrying this Mutation:	31 assay results
In Structures Affected by this Mutation:	6 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Chp1 Mutation: 20 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)