Zmym2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zmym2^em1(IMPC)J
• Name: zinc finger, MYM-type 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6324365
• Synonyms: Zmym2^-
• Gene: Zmym2 Location: Chr14:57123986-57199815 bp, + strand Genetic Position: Chr14, 28.99 cM, cytoband C2
• Alliance: Zmym2^em1(IMPC)J page
• IMPC: Zmym2 gene page

Zmym2^em1(IMPC)J/Zmym2^em1(IMPC)J (-/-) embryos at E9.5 are small, have abnormally shaped heads, branchial arch/ouch defects, and abnormal vascular development of yolk sacs. About half are developmentally delayed, have turning defects and, and exhibit incomplete cranial neural tube closure.

Show the 4 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

Allele Type: Endonuclease-mediated (Null/knockout) Mutations: Insertion, Intragenic deletion Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences CATGCATCAATATAGAGTAC and TTTAACCACAGATTAGATCA that targeted exon(s) ENSMUSE00000309143.4. This resulted in deletion(s) of 2 bp (location: Chr14:57150196-57150197; GRCm39), 321 bp (location: Chr14:57150323-57150643; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794) Inheritance: Not Specified

Strategy for the generation of the Zmym2^em1(IMPC)J allele.

Expression

In Mice Carrying this Mutation:	49 assay results
In Structures Affected by this Mutation:	8 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zmym2 Mutation: 80 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 7 reference(s)