Zmym2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Zmym2em1(IMPC)J |
| Name: |
zinc finger, MYM-type 2; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6324365 |
| Synonyms: |
Zmym2- |
| Gene: |
Zmym2 Location: Chr14:57123986-57199815 bp, + strand Genetic Position: Chr14, 28.99 cM, cytoband C2
|
| Alliance: |
Zmym2em1(IMPC)J page
|
| IMPC: |
Zmym2 gene page |
|
Zmym2em1(IMPC)J/Zmym2em1(IMPC)J (-/-) embryos at E9.5 are small, have abnormally shaped heads, branchial arch/ouch defects, and abnormal vascular development of yolk sacs. About half are developmentally delayed, have turning defects and, and exhibit incomplete cranial neural tube closure.
Show the 4 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTAACCACAGATTAGATCA and CATGCATCAATATAGAGTAC, which resulted in a 321 bp deletion beginning at Chromosome 14 position 56,912,866 bp and ending after 56,913,186 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000309143 (exon 4) and 155 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 377 and early truncation 9 amino acids later. There is an 8 bp insertion (GCATGATT) at the deletion site.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
Strategy for the generation of the Zmym2em1(IMPC)J allele. |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
5 reference(s) |
|