About   Help   FAQ
Zmym2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zmym2em1(IMPC)J
Name: zinc finger, MYM-type 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6324365
Synonyms: Zmym2-
Gene: Zmym2  Location: Chr14:57123986-57199815 bp, + strand  Genetic Position: Chr14, 28.99 cM, cytoband C2
Alliance: Zmym2em1(IMPC)J page
IMPC: Zmym2 gene page
Zmym2em1(IMPC)J/Zmym2em1(IMPC)J (-/-) embryos at E9.5 are small, have abnormally shaped heads, branchial arch/ouch defects, and abnormal vascular development of yolk sacs. About half are developmentally delayed, have turning defects and, and exhibit incomplete cranial neural tube closure.

Show the 4 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTTAACCACAGATTAGATCA and CATGCATCAATATAGAGTAC, which resulted in a 321 bp deletion beginning at Chromosome 14 position 56,912,866 bp and ending after 56,913,186 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000309143 (exon 4) and 155 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 377 and early truncation 9 amino acids later. There is an 8 bp insertion (GCATGATT) at the deletion site. (J:188991)
Inheritance:    Not Specified
Strategy for the generation of the Zmym2em1(IMPC)J allele.
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 33 assay results
In Structures Affected by this Mutation: 9 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zmym2 Mutation:  80 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/14/2026
MGI 6.24
The Jackson Laboratory