About   Help   FAQ
Kctd5em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Kctd5em1(IMPC)J
Name: potassium channel tetramerisation domain containing 5; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6283649
Synonyms: Kctd5-
Gene: Kctd5  Location: Chr17:24266708-24292459 bp, - strand  Genetic Position: Chr17, 12.22 cM, cytoband A3.3
Alliance: Kctd5em1(IMPC)J page
IMPC: Kctd5 gene page
Kctd5em1(IMPC)J/Kctd5em1(IMPC)J embryos exhibit head, heart, embryo turning and posterior cranial neural tube and yolk sac vascularization defects and are developmentally delayed.

Show the 4 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCATCTTCACTCTCCCCAGC and TCACTAGACATACTTACGGA, which resulted in a 583 bp deletion beginning at Chromosome 17 position 24,058,991 bp and ending after 24,059,573 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001262470 (exon 3) and 491 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 120 and early truncation 30 amino acids later. (J:188991)
Inheritance:    Not Specified
Strategy for the generation of the Kctd5em1(IMPC)J allele.
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 30 assay results
In Structures Affected by this Mutation: 6 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Kctd5 Mutation:  13 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory