Kctd5^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kctd5^em1(IMPC)J
• Name: potassium channel tetramerisation domain containing 5; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6283649
• Synonyms: Kctd5^-
• Gene: Kctd5 Location: Chr17:24266708-24292459 bp, - strand Genetic Position: Chr17, 12.22 cM, cytoband A3.3
• Alliance: Kctd5^em1(IMPC)J page
• IMPC: Kctd5 gene page

Kctd5^em1(IMPC)J/Kctd5^em1(IMPC)J embryos exhibit head, heart, embryo turning and posterior cranial neural tube and yolk sac vascularization defects and are developmentally delayed.

Show the 4 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

Allele Type: Endonuclease-mediated (Null/knockout) Mutation: Intragenic deletion Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCATCTTCACTCTCCCCAGC and TCACTAGACATACTTACGGA, which resulted in a 583 bp deletion beginning at Chromosome 17 position 24,058,991 bp and ending after 24,059,573 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001262470 (exon 3) and 491 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 120 and early truncation 30 amino acids later. (J:188991) Inheritance: Not Specified

Strategy for the generation of the Kctd5^em1(IMPC)J allele.

Expression

In Mice Carrying this Mutation:	30 assay results
In Structures Affected by this Mutation:	6 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Kctd5 Mutation: 13 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)