About   Help   FAQ
Got2em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
Summary
Symbol: Got2em1(IMPC)Mbp
Name: glutamatic-oxaloacetic transaminase 2, mitochondrial; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID: MGI:6276937
Synonyms: Got2-
Gene: Got2  Location: Chr8:96590761-96615029 bp, - strand  Genetic Position: Chr8, 47.79 cM
Alliance: Got2em1(IMPC)Mbp page
IMPC: Got2 gene page
Got2em1(IMPC)Mbp/Got2em1(IMPC)Mbp embryos display abnormal head shape and some have abnormal allantois, are developmentally delayed at E9.5, with incomplete turning and defects/delay in cranial neural tube closure, and abnormal heart shape.

Show the 4 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 2 guide sequences GGCGTGGCTCATATACATCGGGG, CCGCAGCTGGCTATTTCTCTCCT, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
Strategy for the generation of the Got2em1(IMPC)Mbp allele.
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 33 assay results
In Structures Affected by this Mutation: 13 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Got2 Mutation:  24 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory