Arpc1a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arpc1a^em1(IMPC)J
• Name: actin related protein 2/3 complex, subunit 1A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6275161
• Synonyms: Arpc1a^-
• Gene: Arpc1a Location: Chr5:145020679-145045566 bp, + strand Genetic Position: Chr5, 85.0 cM
• Alliance: Arpc1a^em1(IMPC)J page
• IMPC: Arpc1a gene page

E9.5 Arpc1a^em1(IMPC)J/Arpc1a^em1(IMPC)J embryos have abnormal head shape, sometimes with incomplete cranial neural tube closure, and about half have branchial arch/pouch abnormalities and abnormal cardiac development. E10.5 embryos are dysmorphic or dying.

Show the 4 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

Allele Type: Endonuclease-mediated (Null/knockout) Mutation: Intragenic deletion Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTGGGCATGGGGTAACTGT and TCATGCACATACGAGTTGAG, which resulted in a 444 bp deletion beginning at Chromosome 5 position 145,095,963 bp and ending after 145,096,406 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001283146 (exon 4) and 221 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 57 and early truncation 1 amino acid later. (J:188991) Inheritance: Not Specified

Strategy for the generation of the Arpc1a^em1(IMPC)J allele.

Expression

In Mice Carrying this Mutation:	36 assay results
In Structures Affected by this Mutation:	8 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Arpc1a Mutation: 28 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)