About   Help   FAQ
Arpc1aem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Arpc1aem1(IMPC)J
Name: actin related protein 2/3 complex, subunit 1A; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6275161
Synonyms: Arpc1a-
Gene: Arpc1a  Location: Chr5:145020679-145045566 bp, + strand  Genetic Position: Chr5, 85.0 cM
Alliance: Arpc1aem1(IMPC)J page
IMPC: Arpc1a gene page
E9.5 Arpc1aem1(IMPC)J/Arpc1aem1(IMPC)J embryos have abnormal head shape, sometimes with incomplete cranial neural tube closure, and about half have branchial arch/pouch abnormalities and abnormal cardiac development. E10.5 embryos are dysmorphic or dying.

Show the 4 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTGGGCATGGGGTAACTGT and TCATGCACATACGAGTTGAG, which resulted in a 444 bp deletion beginning at Chromosome 5 position 145,095,963 bp and ending after 145,096,406 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001283146 (exon 4) and 221 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 57 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Strategy for the generation of the Arpc1aem1(IMPC)J allele.
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 36 assay results
In Structures Affected by this Mutation: 8 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Arpc1a Mutation:  28 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory