Rprd2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rprd2^em1(IMPC)J
• Name: regulation of nuclear pre-mRNA domain containing 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6189568
• Synonyms: Rprd2^-
• Gene: Rprd2 Location: Chr3:95667653-95726175 bp, - strand Genetic Position: Chr3, 41.0 cM, cytoband F2
• Alliance: Rprd2^em1(IMPC)J page
• IMPC: Rprd2 gene page

Rprd2^em1(IMPC)J/Rprd2^em1(IMPC)J embryos are developmentally delayed, show impaired embryo turning, abnormal head shape, caudal neural tube kinks and incomplete cranial neural tube closure, abnormal heart morphology and abnormal yolk sacs.

Show the 4 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

Allele Type: Endonuclease-mediated (Null/knockout) Mutation: Intragenic deletion Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences AGCAAAAATGGGGTGAGCAT, GGTAATAAGAAATTAACTAA, GTGTTATTGGACAAGTGTAA, and TTTTACATGGACTAATTACA that targeted exon(s) ENSMUSE00000176218.2. This resulted in deletion(s) of 522 bp (location: Chr3:95697281-95697802; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794) Inheritance: Not Specified

Strategy for the generation of the Rprd2^em1(IMPC)J allele.

Expression

In Mice Carrying this Mutation:	47 assay results
In Structures Affected by this Mutation:	7 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rprd2 Mutation: 82 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 6 reference(s)