Rprd2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rprd2^em1(IMPC)J
• Name: regulation of nuclear pre-mRNA domain containing 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6189568
• Gene: Rprd2 Location: Chr3:95667653-95726175 bp, - strand Genetic Position: Chr3, 41.0 cM, cytoband F2
• Alliance: Rprd2^em1(IMPC)J page
• IMPC: Rprd2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GTGTTATTGGACAAGTGTAA, TTTTACATGGACTAATTACA, AGCAAAAATGGGGTGAGCAT and GGTAATAAGAAATTAACTAA, which resulted in a 522 bp deletion beginning at Chromosome 3 position 95,789,969 bp and ending after 95,790,490 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000176218 (exon 2) and 392 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 68 and early truncation 8 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rprd2 Mutation: 82 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)