About   Help   FAQ
Rprd2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rprd2em1(IMPC)J
Name: regulation of nuclear pre-mRNA domain containing 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6189568
Synonyms: Rprd2-
Gene: Rprd2  Location: Chr3:95667653-95726175 bp, - strand  Genetic Position: Chr3, 41.0 cM, cytoband F2
Alliance: Rprd2em1(IMPC)J page
IMPC: Rprd2 gene page
Rprd2em1(IMPC)J/Rprd2em1(IMPC)J embryos are developmentally delayed, show impaired embryo turning, abnormal head shape, caudal neural tube kinks and incomplete cranial neural tube closure, abnormal heart morphology and abnormal yolk sacs.

Show the 4 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GTGTTATTGGACAAGTGTAA, TTTTACATGGACTAATTACA, AGCAAAAATGGGGTGAGCAT and GGTAATAAGAAATTAACTAA, which resulted in a 522 bp deletion beginning at Chromosome 3 position 95,789,969 bp and ending after 95,790,490 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000176218 (exon 2) and 392 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 68 and early truncation 8 amino acids later. (J:188991)
Inheritance:    Not Specified
Strategy for the generation of the Rprd2em1(IMPC)J allele.
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 30 assay results
In Structures Affected by this Mutation: 7 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rprd2 Mutation:  82 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory