Tedc2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tedc2^em1(IMPC)J
• Name: tubulin epsilon and delta complex 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6157624
• Synonyms: Tedc2^-
• Gene: Tedc2 Location: Chr17:24434028-24439825 bp, - strand Genetic Position: Chr17, 12.32 cM, cytoband A3.3
• Alliance: Tedc2^em1(IMPC)J page
• IMPC: Tedc2 gene page

Tedc2^em1(IMPC)J/Tedc2^em1(IMPC)J (-/-) embryonic phenotypes include failure to turn, kinked caudal neural tube, laterally splayed and open cranial neural tube, abnormal head and heart shape and cardiac edema.

Show the 5 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

Allele Type: Endonuclease-mediated (Null/knockout) Mutation: Intergenic deletion Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences ACTCATGGCTCAGAACCCAT, AGAATGTTTGGACCATACCA, AGTGCATGACCCTTACGGGT, and CTATCCTTACCCCTTATCCA that targeted exon(s) ENSMUSE00001227889.2 ENSMUSE00001233864.2 ENSMUSE00001305523.2 ENSMUSE00002090859.1 ENSMUSE00002113915.1. This resulted in deletion(s) of 920 bp (location: Chr17:24438442-24439361; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794) Inheritance: Not Specified

Strategy for the generation of the Tedc2^em1(IMPC)J allele.

Expression

In Mice Carrying this Mutation:	42 assay results
In Structures Affected by this Mutation:	8 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tedc2 Mutation: 43 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 6 reference(s)