About   Help   FAQ
Chp1em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Chp1em1(IMPC)Tcp
Name: calcineurin-like EF hand protein 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6388376
Synonyms: Chp1-
Gene: Chp1  Location: Chr2:119378178-119417508 bp, + strand  Genetic Position: Chr2, 59.97 cM
Alliance: Chp1em1(IMPC)Tcp page
IMPC: Chp1 gene page
Chp1em1(IMPC)Tcp/Chp1em1(IMPC)Tcp embryos are developmentally delayed, show abnormal allantois and fragile allantois attachment, impaired embryo turning, abnormal head shape with failed cranial neural tube closure, abnormal heart development, and yolk sac defects.

Show the 5 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR1506 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GAACGCCATGTCAATCACGG targeting the 5' side and GATTGGGCAATAGTCCAACC targeting the 3' side of a critical region. This resulted in a 969-bp deletion Chr2: 119571727-119572695 (GRCm38). (J:265051)
Inheritance:    Not Specified
Strategy for the generation of the Chp1em1(IMPC)Tcp allele.
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 31 assay results
In Structures Affected by this Mutation: 6 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Chp1 Mutation:  20 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory