About   Help   FAQ
Traf7em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Traf7em1(IMPC)Tcp
Name: TNF receptor-associated factor 7; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6388361
Synonyms: Traf7-
Gene: Traf7  Location: Chr17:24727824-24746912 bp, - strand  Genetic Position: Chr17, 12.4 cM
Alliance: Traf7em1(IMPC)Tcp page
IMPC: Traf7 gene page
Traf7em1(IMPC)Tcp/Traf7em1(IMPC)Tcp (-/-) embryos show developmental delay. Almost all E10.5 embryos have abnormal head shape and cardiac tissue, some with enlarged hearts and pericardial edema, abnormal branchial arch development, and abnormal blood deposition. Yolk sacs appear pale.

Show the 4 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR1504 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGCTATTGAGGTCCTTCGCC targeting the 5' side and CCTCTCTGGGGCTACATTGT targeting the 3' side of a critical region. This resulted in a 646-bp del Chr17: 24513114-24513759 (GRCm38). (J:265051)
Inheritance:    Not Specified
Strategy for the generation of the Traf7em1(IMPC)Tcp allele.
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 37 assay results
In Structures Affected by this Mutation: 10 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Traf7 Mutation:  44 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/12/2026
MGI 6.24
The Jackson Laboratory