Plauem1Elne
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Plauem1Elne |
| Name: |
plasminogen activator, urokinase; endonuclease-mediated mutation 1, Elena Neyfeld |
| MGI ID: |
MGI:8348312 |
| Synonyms: |
Plau-D277N |
| Gene: |
Plau Location: Chr14:20886728-20893453 bp, + strand Genetic Position: Chr14, 11.53 cM
|
| Alliance: |
Plauem1Elne page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Single point mutation
|
| |
|
Mutation details:
Aspartic acid codon 277 (GAT) was changed to asparagine (AAT) (p.D277N) using an sgRNA (UCUGCUCACCAAUAUCAUUA) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the catalytic domain of the encoded protein, is the equivalent of human C>T SNP rs1243306395, associated with autism spectrum disorders (ASD). In mice it enhances enzymatic activity, which leads to increased anxiety and impaired social behavior.
(J:386319)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Plau Mutation: |
31 strains or lines available
|
|
| Original: |
J:386319 Karagyaur M, et al., Novel mouse line with D277N mutation in the Plau gene displays autism spectrum disorder-like traits. Front Cell Dev Biol. 2026;14:1762737 |
| All: |
1 reference(s) |
|