Plau^em1Elne
Endonuclease-mediated Allele Detail

Summary

• Symbol: Plau^em1Elne
• Name: plasminogen activator, urokinase; endonuclease-mediated mutation 1, Elena Neyfeld
• MGI ID: MGI:8348312
• Synonyms: Plau-D277N
• Gene: Plau Location: Chr14:20886728-20893453 bp, + strand Genetic Position: Chr14, 11.53 cM
• Alliance: Plau^em1Elne page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Aspartic acid codon 277 (GAT) was changed to asparagine (AAT) (p.D277N) using an sgRNA (UCUGCUCACCAAUAUCAUUA) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the catalytic domain of the encoded protein, is the equivalent of human C>T SNP rs1243306395, associated with autism spectrum disorders (ASD). In mice it enhances enzymatic activity, which leads to increased anxiety and impaired social behavior. (J:386319)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Plau Mutation: 29 strains or lines available

References

• Original: J:386319 Karagyaur M, et al., Novel mouse line with D277N mutation in the Plau gene displays autism spectrum disorder-like traits. Front Cell Dev Biol. 2026;14:1762737
• All: 1 reference(s)