About   Help   FAQ
Plauem1Elne
Endonuclease-mediated Allele Detail
Summary
Symbol: Plauem1Elne
Name: plasminogen activator, urokinase; endonuclease-mediated mutation 1, Elena Neyfeld
MGI ID: MGI:8348312
Synonyms: Plau-D277N
Gene: Plau  Location: Chr14:20886728-20893453 bp, + strand  Genetic Position: Chr14, 11.53 cM
Alliance: Plauem1Elne page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation details: 

Aspartic acid codon 277 (GAT) was changed to asparagine (AAT) (p.D277N) using an sgRNA (UCUGCUCACCAAUAUCAUUA) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the catalytic domain of the encoded protein, is the equivalent of human C>T SNP rs1243306395, associated with autism spectrum disorders (ASD). In mice it enhances enzymatic activity, which leads to increased anxiety and impaired social behavior. (J:386319)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Plau Mutation:  31 strains or lines available
References
Original:  J:386319 Karagyaur M, et al., Novel mouse line with D277N mutation in the Plau gene displays autism spectrum disorder-like traits. Front Cell Dev Biol. 2026;14:1762737
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/08/2026
MGI 6.24
The Jackson Laboratory