Jarid2em1Chend
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Jarid2em1Chend |
| Name: |
jumonji and AT-rich interaction domain containing 2; endonuclease-mediated mutation 1, Chen Davidovich |
| MGI ID: |
MGI:8326310 |
| Synonyms: |
Jarid2 K116R, Jarid2SOF |
| Gene: |
Jarid2 Location: Chr13:44882950-45075119 bp, + strand Genetic Position: Chr13, 21.66 cM
|
| Alliance: |
Jarid2em1Chend page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Not Applicable) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details:
Lysine codon 116 (AAG) was changed to arginine (CGC) (p.K116R) using an sgRNA (equivalent to GGCCCAGGCTGCAAGCACAA) and an ssODN template with CRISPR/Cas9 technology. The encoded protein is part of the Polycomb repressive complex 2 (PRC2) and the mutation blocks methylation of the affected residue, which disrupts the complex's function, resulting the change of identity of anterior lumbar vertebra L1 to a posterior thoracic vertebra in late-stage embryos.
(J:383110)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Jarid2 Mutation: |
374 strains or lines available
|
|
| Original: |
J:383110 Agius SC, et al., Accessory subunits of PRC2 mimic H3K27me3 to restrict the spread of Polycomb domains. Mol Cell. 2026 Mar 19;86(6):1032-1045.e10 |
| All: |
1 reference(s) |
|