About   Help   FAQ
Jarid2em1Chend
Endonuclease-mediated Allele Detail
Summary
Symbol: Jarid2em1Chend
Name: jumonji and AT-rich interaction domain containing 2; endonuclease-mediated mutation 1, Chen Davidovich
MGI ID: MGI:8326310
Synonyms: Jarid2 K116R, Jarid2SOF
Gene: Jarid2  Location: Chr13:44882950-45075119 bp, + strand  Genetic Position: Chr13, 21.66 cM
Alliance: Jarid2em1Chend page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation details: 

Lysine codon 116 (AAG) was changed to arginine (CGC) (p.K116R) using an sgRNA (equivalent to GGCCCAGGCTGCAAGCACAA) and an ssODN template with CRISPR/Cas9 technology. The encoded protein is part of the Polycomb repressive complex 2 (PRC2) and the mutation blocks methylation of the affected residue, which disrupts the complex's function, resulting the change of identity of anterior lumbar vertebra L1 to a posterior thoracic vertebra in late-stage embryos. (J:383110)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Jarid2 Mutation:  374 strains or lines available
References
Original:  J:383110 Agius SC, et al., Accessory subunits of PRC2 mimic H3K27me3 to restrict the spread of Polycomb domains. Mol Cell. 2026 Mar 19;86(6):1032-1045.e10
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/08/2026
MGI 6.24
The Jackson Laboratory