Jarid2^em1Chend
Endonuclease-mediated Allele Detail

Summary

• Symbol: Jarid2^em1Chend
• Name: jumonji and AT-rich interaction domain containing 2; endonuclease-mediated mutation 1, Chen Davidovich
• MGI ID: MGI:8326310
• Synonyms: Jarid2 K116R, Jarid2^SOF
• Gene: Jarid2 Location: Chr13:44882950-45075119 bp, + strand Genetic Position: Chr13, 21.66 cM
• Alliance: Jarid2^em1Chend page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Lysine codon 116 (AAG) was changed to arginine (CGC) (p.K116R) using an sgRNA (equivalent to GGCCCAGGCTGCAAGCACAA) and an ssODN template with CRISPR/Cas9 technology. The encoded protein is part of the Polycomb repressive complex 2 (PRC2) and the mutation blocks methylation of the affected residue, which disrupts the complex's function, resulting the change of identity of anterior lumbar vertebra L1 to a posterior thoracic vertebra in late-stage embryos. (J:383110)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Jarid2 Mutation: 374 strains or lines available

References

• Original: J:383110 Agius SC, et al., Accessory subunits of PRC2 mimic H3K27me3 to restrict the spread of Polycomb domains. Mol Cell. 2026 Mar 19;86(6):1032-1045.e10
• All: 1 reference(s)