About   Help   FAQ
Vangl1em1Bgao
Endonuclease-mediated Allele Detail
Summary
Symbol: Vangl1em1Bgao
Name: VANGL planar cell polarity 1; endonuclease-mediated mutation 1, Bo Gao
MGI ID: MGI:8283332
Synonyms: Vangl1R258H
Gene: Vangl1  Location: Chr3:102060899-102112009 bp, - strand  Genetic Position: Chr3, 44.3 cM
Alliance: Vangl1em1Bgao page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsArginine codon 258 (CGC) in exon 4 was changed to histidine (CAC) (p.R258H) using an sgRNA (equivalent to GAAGCGGGACTCTCCGTCGGTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.R256H mutation associated with congenital scoliosis (CS). (J:357898)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Vangl1 Mutation:  86 strains or lines available
References
Original:  J:357898 Feng X, et al., Core planar cell polarity genes VANGL1 and VANGL2 in predisposition to congenital vertebral malformations. Proc Natl Acad Sci U S A. 2024 Apr 30;121(18):e2310283121
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory