Vangl1^em1Bgao
Endonuclease-mediated Allele Detail

Summary

• Symbol: Vangl1^em1Bgao
• Name: VANGL planar cell polarity 1; endonuclease-mediated mutation 1, Bo Gao
• MGI ID: MGI:8283332
• Synonyms: Vangl1^R258H
• Gene: Vangl1 Location: Chr3:102060899-102112009 bp, - strand Genetic Position: Chr3, 44.3 cM
• Alliance: Vangl1^em1Bgao page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Arginine codon 258 (CGC) in exon 4 was changed to histidine (CAC) (p.R258H) using an sgRNA (equivalent to GAAGCGGGACTCTCCGTCGGTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.R256H mutation associated with congenital scoliosis (CS). (J:357898)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Vangl1 Mutation: 86 strains or lines available

References

• Original: J:357898 Feng X, et al., Core planar cell polarity genes VANGL1 and VANGL2 in predisposition to congenital vertebral malformations. Proc Natl Acad Sci U S A. 2024 Apr 30;121(18):e2310283121
• All: 1 reference(s)