Piezo1^em1Bxiao
Endonuclease-mediated Allele Detail

Summary

• Symbol: Piezo1^em1Bxiao
• Name: piezo-type mechanosensitive ion channel component 1; endonuclease-mediated mutation 1, Bailong Xiao
• MGI ID: MGI:8275336
• Synonyms: Piezo1-S1612A
• Gene: Piezo1 Location: Chr8:123208437-123278068 bp, - strand Genetic Position: Chr8, 71.31 cM
• Alliance: Piezo1^em1Bxiao page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Serine codon 1612 (AGT) in exon 36 was changed to alanine (GCT) (p.S1612A) using an sgRNA (equivalent to TAACACCCGCAGTGGCAGTG) and an ssODN template with CRISPR/Cas9 technology. In the encoded protein the mutation replaces a residue that can be phosphorylated with one that cannot, which affects blood pressure and exercise endurance. (J:360618)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Piezo1 Mutation: 88 strains or lines available

References

• Original: J:360618 Zhang T, et al., Phosphorylation of Piezo1 at a single residue, serine-1612, regulates its mechanosensitivity and in vivo mechanotransduction function. Neuron. 2024 Sep 10
• All: 1 reference(s)