About   Help   FAQ
Piezo1em1Bxiao
Endonuclease-mediated Allele Detail
Summary
Symbol: Piezo1em1Bxiao
Name: piezo-type mechanosensitive ion channel component 1; endonuclease-mediated mutation 1, Bailong Xiao
MGI ID: MGI:8275336
Synonyms: Piezo1-S1612A
Gene: Piezo1  Location: Chr8:123208437-123278068 bp, - strand  Genetic Position: Chr8, 71.31 cM
Alliance: Piezo1em1Bxiao page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsSerine codon 1612 (AGT) in exon 36 was changed to alanine (GCT) (p.S1612A) using an sgRNA (equivalent to TAACACCCGCAGTGGCAGTG) and an ssODN template with CRISPR/Cas9 technology. In the encoded protein the mutation replaces a residue that can be phosphorylated with one that cannot, which affects blood pressure and exercise endurance. (J:360618)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Piezo1 Mutation:  88 strains or lines available
References
Original:  J:360618 Zhang T, et al., Phosphorylation of Piezo1 at a single residue, serine-1612, regulates its mechanosensitivity and in vivo mechanotransduction function. Neuron. 2024 Sep 10;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory