Stat5b^em2Mam
Endonuclease-mediated Allele Detail

Summary

• Symbol: Stat5b^em2Mam
• Name: signal transducer and activator of transcription 5B; endonuclease-mediated mutation 2, Lothar Hennighausen
• MGI ID: MGI:8204545
• Synonyms: Stat5b^Y665F
• Gene: Stat5b Location: Chr11:100671557-100741407 bp, - strand Genetic Position: Chr11, 63.63 cM
• Alliance: Stat5b^em2Mam page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Tyrosine codon 665 (TAC) was changed to phenylalanine (TTT) (p.Y665F) using an sgRNA (targeting TGAGGTAATTCAGGTCCCCCAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the SH2 domain of the encoded protein, is the equivalent of the same human mutation associated with T-cell large granular lymphoblastic leukemia (T-LGLL) and T-cell prolymphocytic leukemia (T-PLL). Y665F replaces the sidechain with a more hydrophobic form of essentially the same type, possibly stabilizing the fold even more, predicting a gain-of-function mutation. (J:365015)

Expression

In Mice Carrying this Mutation:	1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Stat5b Mutation: 33 strains or lines available

References

• Original: J:365015 Lee HK, et al., Disease-Associated Mutations of the STAT5B SH2 Domain Regulate Cytokine-Driven Enhancer Function and Mammary Development. J Mammary Gland Biol Neoplasia. 2025 Mar 31;30(1):7
• All: 3 reference(s)