Rag2^em5Lutzy
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rag2^em5Lutzy
• Name: recombination activating gene 2; endonuclease-mediated mutation 5, Cathy Lutz
• MGI ID: MGI:6877074
• Gene: Rag2 Location: Chr2:101455063-101462874 bp, + strand Genetic Position: Chr2, 53.87 cM
• Alliance: Rag2^em5Lutzy page

Mutation origin

• Strain of Origin: BALB/cByJ

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/cas9 genome editing used guide RNAs to target upstream [AGCCAGTCCGCCACTAAAAT ; GACCTATTTTAGTGGCGGAC] and downstream [CCCCCCGGTTACTTGTGATT ; CACCTAATCACAAGTAACCG] of exon 3. Progeny were screened by DNA sequencing of the targeted region, which identified founder 4341 harboring a 2449-nt deletion that resulted in the complete loss of exon 3. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rag2 Mutation: 115 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)