Gmeb2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gmeb2^em1(IMPC)J
• Name: glucocorticoid modulatory element binding protein 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6766467
• Synonyms: Gmeb2^-
• Gene: Gmeb2 Location: Chr2:180893242-180929828 bp, - strand Genetic Position: Chr2, 103.63 cM
• Alliance: Gmeb2^em1(IMPC)J page
• IMPC: Gmeb2 gene page

Gmeb2^em1(IMPC)J/Gmeb2^em1(IMPC)J are small and developmentally delayed, show incomplete turning, mild caudal neural tube kinking, abnormal tail morphology, and abnormal head shape. A few show abnormal heart morphology. Yolk sacs are pale or abnormally vascularized.

Show the 4 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

Allele Type: Endonuclease-mediated (Null/knockout) Mutation: Intragenic deletion Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences CCAAGAATCCGGTAGAGAAC and TCTGACGAGTCTGAGATGAT that targeted exon(s) ENSMUSE00001242983.2. This resulted in deletion(s) of 363 bp (location: Chr2:180902064-180902426; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794) Inheritance: Not Specified

Strategy for the generation of theGmeb2^em1(IMPC)J allele.

Expression

In Mice Carrying this Mutation:	48 assay results
In Structures Affected by this Mutation:	7 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gmeb2 Mutation: 56 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 6 reference(s)