Gmeb2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gmeb2^em1(IMPC)J
• Name: glucocorticoid modulatory element binding protein 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6766467
• Synonyms: Gmeb2^-
• Gene: Gmeb2 Location: Chr2:180893242-180929828 bp, - strand Genetic Position: Chr2, 103.63 cM
• Alliance: Gmeb2^em1(IMPC)J page
• IMPC: Gmeb2 gene page

Gmeb2^em1(IMPC)J/Gmeb2^em1(IMPC)J are small and developmentally delayed, show incomplete turning, mild caudal neural tube kinking, abnormal tail morphology, and abnormal head shape. A few show abnormal heart morphology. Yolk sacs are pale or abnormally vascularized.

Show the 4 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

Allele Type: Endonuclease-mediated (Null/knockout) Mutation: Intragenic deletion Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTGACGAGTCTGAGATGAT and CCAAGAATCCGGTAGAGAAC, which resulted in a 363 bp deletion beginning at Chromosome 2 position 180,902,064 bp and ending after 180,902,426 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001242983 (exon 5) and 259 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 119 and early truncation 13 amino acids later. (J:188991) Inheritance: Not Specified

Strategy for the generation of theGmeb2^em1(IMPC)J allele.

Expression

In Mice Carrying this Mutation:	32 assay results
In Structures Affected by this Mutation:	8 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gmeb2 Mutation: 56 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)