About   Help   FAQ
Gmeb2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gmeb2em1(IMPC)J
Name: glucocorticoid modulatory element binding protein 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6766467
Synonyms: Gmeb2-
Gene: Gmeb2  Location: Chr2:180893242-180929828 bp, - strand  Genetic Position: Chr2, 103.63 cM
Alliance: Gmeb2em1(IMPC)J page
IMPC: Gmeb2 gene page
Gmeb2em1(IMPC)J/Gmeb2em1(IMPC)J are small and developmentally delayed, show incomplete turning, mild caudal neural tube kinking, abnormal tail morphology, and abnormal head shape. A few show abnormal heart morphology. Yolk sacs are pale or abnormally vascularized.

Show the 4 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTGACGAGTCTGAGATGAT and CCAAGAATCCGGTAGAGAAC, which resulted in a 363 bp deletion beginning at Chromosome 2 position 180,902,064 bp and ending after 180,902,426 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001242983 (exon 5) and 259 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 119 and early truncation 13 amino acids later. (J:188991, J:384794)
Inheritance:    Not Specified
Strategy for the generation of theGmeb2em1(IMPC)J allele.
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 44 assay results
In Structures Affected by this Mutation: 7 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gmeb2 Mutation:  56 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  6 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/09/2026
MGI 6.24
The Jackson Laboratory