About   Help   FAQ
Nr3c1em2Clib
Endonuclease-mediated Allele Detail
Summary
Symbol: Nr3c1em2Clib
Name: nuclear receptor subfamily 3, group C, member 1; endonuclease-mediated mutation 2, Claude Libert
MGI ID: MGI:6511988
Synonyms: GRA465T,I634A, GRdim1,dim2, GRD+L
Gene: Nr3c1  Location: Chr18:39543598-39652474 bp, - strand  Genetic Position: Chr18, 21.09 cM
Alliance: Nr3c1em2Clib page
Mutation
origin
Strain of Origin:  FVB/NJ
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsUsing an sgRNA (targeting GCTATGCTTTGCTCCTGA) and ssODN template (G GCATTTGCCCTGGGTTGGAGATCATACAGACAAGCAAGTGGAAACCTGCTATGCTTTGCTCCTGATCTGATTATTAATGAGTAAGTTACATGGCCTTAACCCTCCACAAAGAACTA) with CRISPR/Cas9 technology, isoleucine codon 643 (ATT) in exon 6 was changed to alanine (GCT) (p.I643A). Targeting was performed in Nr3c1tm3Gsc heterozygote zygotes to produce mice with either p.I643A only (Nr3c1em1Clib) or p.I643A plus p.A474T in cis (this allele). Peptide coordinates are in reference to canonical sequence SW:P06537-1 with the full complement of polyQ at the N-terminal end. (J:303222, J:322619)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Nr3c1 Mutation:  36 strains or lines available
Notes
This allele was generated from Nr3c1tm3Gsc.
References
Original:  J:303222 Libert C, Direct Data Submission for two Nr3c1 alleles. MGI Direct Data Submission. 2021;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory