Nr3c1em1Clib
Endonuclease-mediated Allele Detail
|
Symbol: |
Nr3c1em1Clib |
Name: |
nuclear receptor subfamily 3, group C, member 1; endonuclease-mediated mutation 1, Claude Libert |
MGI ID: |
MGI:6512048 |
Synonyms: |
GRdim2, GRI634A, GRL |
Gene: |
Nr3c1 Location: Chr18:39543598-39652474 bp, - strand Genetic Position: Chr18, 21.09 cM
|
Alliance: |
Nr3c1em1Clib page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Not Applicable) |
Mutation: |
|
Nucleotide substitutions
|
|
|
Mutation details: Using an sgRNA (targeting GCTATGCTTTGCTCCTGA) and ssODN template (G GCATTTGCCCTGGGTTGGAGATCATACAGACAAGCAAGTGGAAACCTGCTATGCTTTGCTCCTGATCTGATTATTAATGAGTAAGTTACATGGCCTTAACCCTCCACAAAGAACTA) with CRISPR/Cas9 technology, isoleucine codon 643 (ATT) in exon 6 was changed to alanine (GCT) (p.I643A). Targeting was performed in Nr3c1tm3Gsc heterozygote zygotes to produce mice with either p.I643A only (this allele) or p.I643A plus p.A474T in cis (Nr3c1em2Clib). Peptide coordinates are in reference to canonical sequence SW:P06537-1 with the full complement of polyQ at the N-terminal end.
(J:303222, J:322619)
|
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Nr3c1 Mutation: |
35 strains or lines available
|
|
Original: |
J:303222 Libert C, Direct Data Submission for two Nr3c1 alleles. MGI Direct Data Submission. 2021; |
All: |
2 reference(s) |
|