About   Help   FAQ
Sprr2fem1Jadb
Endonuclease-mediated Allele Detail
Summary
Symbol: Sprr2fem1Jadb
Name: small proline-rich protein 2F; endonuclease-mediated mutation 1, James D Brooks
MGI ID: MGI:6510021
Synonyms: Sprr2f-
Gene: Sprr2f  Location: Chr3:92272494-92273749 bp, + strand  Genetic Position: Chr3, 40.14 cM
Alliance: Sprr2fem1Jadb page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsExon 2, containing the CDS, was targeted with two sgRNAs (targeting AGACAGGCAGTCTCGAGTTC and GGGGAAGAGTACTTTCTATG) using CRISPR/Cas9 technology, resulting in a 1258 bp deletion (including the entire exon). Lack of transcript expression from this allele was confirmed by qRT-PCR. (J:299874)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Sprr2f Mutation:  13 strains or lines available
References
Original:  J:299874 Huynh KM, et al., Sprr2f protects against renal injury by decreasing the level of reactive oxygen species in female mice. Am J Physiol Renal Physiol. 2020 Nov 1;319(5):F876-F884
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory