About   Help   FAQ
Amigo2em#Dke
Endonuclease-mediated Allele Detail
Summary
Symbol: Amigo2em#Dke
Name: adhesion molecule with Ig like domain 2; endonuclease-mediated mutation, Daniel Kerschensteiner
MGI ID: MGI:6478808
Synonyms: Amigo KO
Gene: Amigo2  Location: Chr15:97142006-97145168 bp, - strand  Genetic Position: Chr15, 52.91 cM
Alliance: Amigo2em#Dke page
Mutation
origin
Strain of Origin:  C57BL/6J x DBA/2
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsDeletions were created by targeting TALENs to TCAGGAATGTGCCCCACTGC and TTGGTGCAGCTGACAATGTC. Four mouse lines, with 2-bp, 8-bp, 22-bp, and 43-bp deletions, respectively, were selected for further breeding and experimental data from these four lines was pooled. The pound # sign in the allele symbol is used for this pooled allele. (J:292404)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Amigo2 Mutation:  26 strains or lines available
References
Original:  J:292404 Soto F, et al., AMIGO2 Scales Dendrite Arbors in the Retina. Cell Rep. 2019 Nov 5;29(6):1568-1578.e4
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory