Slc30a9^em1(IMPC)Bay
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc30a9^em1(IMPC)Bay
• Name: solute carrier family 30 (zinc transporter), member 9; endonuclease-mediated mutation 1, Baylor College of Medicine
• MGI ID: MGI:6414508
• Synonyms: Slc30a9^-
• Gene: Slc30a9 Location: Chr5:67464298-67513485 bp, + strand Genetic Position: Chr5, 36.02 cM
• Alliance: Slc30a9^em1(IMPC)Bay page
• IMPC: Slc30a9 gene page

Slc30a9^em1(IMPC)Bay/Slc30a9^em1(IMPC)Bay embryos at E8.5 are smaller, have an abnormal allantois and sometimes abnormal head shape. By E9.5, all embryos are developmentally delayed, have an abnormal head shape and abnormal yolk sacs, are unturned and have failed to close their cranial neural tube.

Show the 5 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

Allele Type: Endonuclease-mediated (Null/knockout) Mutation: Intragenic deletion Mutation details: This allele was generated at Baylor College of Medicine using Cas9 and guides with spacer sequences AACCCAGCATGCACTGCGCT and GAGAAAATAATAAGTGTCCG that targeted exon(s) ENSMUSE00000187074.4 ENSMUSE00000251729.4. This resulted in deletion(s) of 1077 bp (location: Chr5:67484098-67485174; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794) Inheritance: Not Specified

Strategy for the generation of the Slc30a9^em1(IMPC)Bay allele.

Expression

In Mice Carrying this Mutation:	31 assay results
In Structures Affected by this Mutation:	11 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Slc30a9 Mutation: 34 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 6 reference(s)