About   Help   FAQ
Slc30a9em1(IMPC)Bay
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc30a9em1(IMPC)Bay
Name: solute carrier family 30 (zinc transporter), member 9; endonuclease-mediated mutation 1, Baylor College of Medicine
MGI ID: MGI:6414508
Synonyms: Slc30a9-
Gene: Slc30a9  Location: Chr5:67464298-67513485 bp, + strand  Genetic Position: Chr5, 36.02 cM
Alliance: Slc30a9em1(IMPC)Bay page
IMPC: Slc30a9 gene page
Slc30a9em1(IMPC)Bay/Slc30a9em1(IMPC)Bay embryos at E8.5 are smaller, have an abnormal allantois and sometimes abnormal head shape. By E9.5, all embryos are developmentally delayed, have an abnormal head shape and abnormal yolk sacs, are unturned and have failed to close their cranial neural tube.

Show the 5 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 2 guide sequences CCTAGCGCAGTGCATGCTGGGTT, GAGAAAATAATAAGTGTCCGTGG, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
Strategy for the generation of the Slc30a9em1(IMPC)Bay allele.
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 22 assay results
In Structures Affected by this Mutation: 12 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Slc30a9 Mutation:  34 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory