About   Help   FAQ
Rr172em1Kmm
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr172em1Kmm
Name: regulatory region 172; endonuclease-mediated mutation 1, Kenneth Murphy
MGI ID: MGI:6368518
Synonyms: Irf8 +32-, Irf8em1Kmm
Gene: Rr172  Location: Chr8:121495079-121495626 bp  Genetic Position: Chr8, Syntenic
Alliance: Rr172em1Kmm page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsPlasmids encoding sgRNA (gttgtgatctttgaggtaga, gtctccttctgaaatttcagtt, and gaactggcctggggcaggtc) are designed to delete one of two enhancers located in the super-enhancer of the gene +32 kb downstream from the transcriptional start site. The 421 bp deletion results in elimination all four AP1-IRF composite elements (AICEs) in the +32-kb Irf8 enhancer. (J:279982)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr172 Mutation:  0 strains or lines available
References
Original:  J:279982 Durai V, et al., Cryptic activation of an Irf8 enhancer governs cDC1 fate specification. Nat Immunol. 2019 Sep;20(9):1161-1173
All:  13 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory