Ehbp1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ehbp1^em1(IMPC)J
• Name: EH domain binding protein 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6342439
• Synonyms: Ehbp1^-
• Gene: Ehbp1 Location: Chr11:21955825-22237086 bp, - strand Genetic Position: Chr11, 14.1 cM
• Alliance: Ehbp1^em1(IMPC)J page
• IMPC: Ehbp1 gene page

Ehbp1^em1(IMPC)J/Ehbp1^em1(IMPC)J embryos are often smaller, are incompletely turned, have abnormal heads, and most have caudal neural tube kinks, abnormally shaped hearts, branchial arch defects, and misshapen tail tip. Some have incomplete cranial neural tube closure and pale yolk sacs.

Show the 4 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

Allele Type: Endonuclease-mediated (Null/knockout) Mutation: Intragenic deletion Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTGCGCCCATCCACTAAGA and GGCATAAATATTTATACTAG, which resulted in a 379 bp deletion beginning at Chromosome 11 position 22,172,810 bp and ending after 22,173,188 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001235276 (exon 6) and 197 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 104 and early truncation 1 amino acids later. There is a 6 bp deletion CTTAGG 4 bp after the 379 bp deletion. (J:188991) Inheritance: Not Specified

Strategy for the generation of the Ehbp1^em1(IMPC)J allele.

Expression

In Mice Carrying this Mutation:	30 assay results
In Structures Affected by this Mutation:	11 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ehbp1 Mutation: 76 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)