Ehbp1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ehbp1em1(IMPC)J |
| Name: |
EH domain binding protein 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6342439 |
| Synonyms: |
Ehbp1- |
| Gene: |
Ehbp1 Location: Chr11:21955825-22237086 bp, - strand Genetic Position: Chr11, 14.1 cM
|
| Alliance: |
Ehbp1em1(IMPC)J page
|
| IMPC: |
Ehbp1 gene page |
|
At E9.5, Ehbp1em1(IMPC)J/Ehbp1em1(IMPC)J placentas are properly developed.
Show the 4 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTGCGCCCATCCACTAAGA and GGCATAAATATTTATACTAG, which resulted in a 379 bp deletion beginning at Chromosome 11 position 22,172,810 bp and ending after 22,173,188 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001235276 (exon 6) and 197 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 104 and early truncation 1 amino acids later. There is a 6 bp deletion CTTAGG 4 bp after the 379 bp deletion.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
Strategy for the generation of the Ehbp1em1(IMPC)J allele. |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|