About   Help   FAQ
Ehbp1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ehbp1em1(IMPC)J
Name: EH domain binding protein 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6342439
Synonyms: Ehbp1-
Gene: Ehbp1  Location: Chr11:21955825-22237086 bp, - strand  Genetic Position: Chr11, 14.1 cM
Alliance: Ehbp1em1(IMPC)J page
IMPC: Ehbp1 gene page
Ehbp1em1(IMPC)J/Ehbp1em1(IMPC)J embryos are often smaller, are incompletely turned, have abnormal heads, and most have caudal neural tube kinks, abnormally shaped hearts, branchial arch defects, and misshapen tail tip. Some have incomplete cranial neural tube closure and pale yolk sacs.

Show the 4 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details:  This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences CCTGCGCCCATCCACTAAGA and GGCATAAATATTTATACTAG that targeted exon(s) ENSMUSE00001235276.2. This resulted in deletion(s) of 6 bp (location: Chr11:22122799-22122804; GRCm39), 379 bp (location: Chr11:22122810-22123188; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Inheritance:    Not Specified
Strategy for the generation of the Ehbp1em1(IMPC)J allele.
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 42 assay results
In Structures Affected by this Mutation: 11 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ehbp1 Mutation:  76 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  6 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/08/2026
MGI 6.24
The Jackson Laboratory