Ppoxem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ppoxem1(IMPC)J |
| Name: |
protoporphyrinogen oxidase; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6303599 |
| Synonyms: |
Ppox- |
| Gene: |
Ppox Location: Chr1:171104564-171108955 bp, - strand Genetic Position: Chr1, 79.3 cM, cytoband H2
|
| Alliance: |
Ppoxem1(IMPC)J page
|
| IMPC: |
Ppox gene page |
|
Ppoxem1(IMPC)J/Ppoxem1(IMPC)J embryos are small and sometimes delayed, have an abnormal head, allantois, almost always open cranial neural tube and caudal neural tube kinks, and impaired cardiac development and embryo turning.
Show the 3 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences AGTGAAGCACTGTCGCCACA and CGAGCTGCTGGACGGACGAG that targeted exon(s) ENSMUSE00000504002.2 ENSMUSE00000505786.2 ENSMUSE00001209397.2 ENSMUSE00001221905.2 ENSMUSE00001239776.2 ENSMUSE00001244557.2 ENSMUSE00001248877.2 ENSMUSE00001253142.2 ENSMUSE00001280066.2 ENSMUSE00001340994.2 ENSMUSE00001341847.2 ENSMUSE00001372270.2 ENSMUSE00001790115.1 ENSMUSE00001790121.1 ENSMUSE00001790132.1 ENSMUSE00002164116.1 ENSMUSE00002164117.1. This resulted in deletion(s) of 3291 bp (location: Chr1:171104833-171108123; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
Strategy for the generation of the Ppoxem1(IMPC)J allele. |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
6 reference(s) |
|