Ppox^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ppox^em1(IMPC)J
• Name: protoporphyrinogen oxidase; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6303599
• Synonyms: Ppox^-
• Gene: Ppox Location: Chr1:171104564-171108955 bp, - strand Genetic Position: Chr1, 79.3 cM, cytoband H2
• Alliance: Ppox^em1(IMPC)J page
• IMPC: Ppox gene page

Ppox^em1(IMPC)J/Ppox^em1(IMPC)J embryos are small and sometimes delayed, have an abnormal head, allantois, almost always open cranial neural tube and caudal neural tube kinks, and impaired cardiac development and embryo turning.

Show the 3 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

Allele Type: Endonuclease-mediated (Null/knockout) Mutation: Intragenic deletion Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences AGTGAAGCACTGTCGCCACA and CGAGCTGCTGGACGGACGAG that targeted exon(s) ENSMUSE00000504002.2 ENSMUSE00000505786.2 ENSMUSE00001209397.2 ENSMUSE00001221905.2 ENSMUSE00001239776.2 ENSMUSE00001244557.2 ENSMUSE00001248877.2 ENSMUSE00001253142.2 ENSMUSE00001280066.2 ENSMUSE00001372270.2. This resulted in deletion(s) of 3291 bp (location: Chr1:171104833-171108123; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794) Inheritance: Not Specified

Strategy for the generation of the Ppox^em1(IMPC)J allele.

Expression

In Mice Carrying this Mutation:	40 assay results
In Structures Affected by this Mutation:	8 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ppox Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 6 reference(s)