Ppox^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ppox^em1(IMPC)J
• Name: protoporphyrinogen oxidase; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6303599
• Synonyms: Ppox^-
• Gene: Ppox Location: Chr1:171104564-171108955 bp, - strand Genetic Position: Chr1, 79.3 cM, cytoband H2
• Alliance: Ppox^em1(IMPC)J page
• IMPC: Ppox gene page

Ppox^em1(IMPC)J/Ppox^em1(IMPC)J embryos are small and sometimes delayed, have an abnormal head, allantois, almost always open cranial neural tube and caudal neural tube kinks, and impaired cardiac development and embryo turning.

Show the 3 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

Allele Type: Endonuclease-mediated (Null/knockout) Mutation: Intragenic deletion Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGAGCTGCTGGACGGACGAG and AGTGAAGCACTGTCGCCACA, which resulted in a 3290 bp deletion beginning at Chromosome 1 position 171,277,260 bp and ending after 171,280,549 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001209397 - ENSMUSE00001248877 (exons 3-12) and 2086 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 29 and early truncation 6 amino acids later. (J:188991) Inheritance: Not Specified

Strategy for the generation of the Ppox^em1(IMPC)J allele.

Expression

In Mice Carrying this Mutation:	24 assay results
In Structures Affected by this Mutation:	8 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ppox Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)