About   Help   FAQ
Ppoxem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ppoxem1(IMPC)J
Name: protoporphyrinogen oxidase; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6303599
Synonyms: Ppox-
Gene: Ppox  Location: Chr1:171104564-171108955 bp, - strand  Genetic Position: Chr1, 79.3 cM, cytoband H2
Alliance: Ppoxem1(IMPC)J page
IMPC: Ppox gene page
Ppoxem1(IMPC)J/Ppoxem1(IMPC)J embryos are small and sometimes delayed, have an abnormal head, allantois, almost always open cranial neural tube and caudal neural tube kinks, and impaired cardiac development and embryo turning.

Show the 3 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGAGCTGCTGGACGGACGAG and AGTGAAGCACTGTCGCCACA, which resulted in a 3290 bp deletion beginning at Chromosome 1 position 171,277,260 bp and ending after 171,280,549 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001209397 - ENSMUSE00001248877 (exons 3-12) and 2086 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 29 and early truncation 6 amino acids later. (J:188991)
Inheritance:    Not Specified
Strategy for the generation of the Ppoxem1(IMPC)J allele.
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 24 assay results
In Structures Affected by this Mutation: 8 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ppox Mutation:  31 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory