About   Help   FAQ
Spty2d1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Spty2d1em1(IMPC)J
Name: SPT2 chromatin protein domain containing 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6294149
Synonyms: Spty2d1-
Gene: Spty2d1  Location: Chr7:46640144-46658159 bp, - strand  Genetic Position: Chr7, 30.66 cM
Alliance: Spty2d1em1(IMPC)J page
IMPC: Spty2d1 gene page
Spty2d1em1(IMPC)J/Spty2d1em1(IMPC)J (-/-) embryonic phenotype. Embryos are smaller, some have abnormally shaped heads and abnormal blood pooling. By E11.5, some start dying and those alive show abnormal blood pooling in and near the heart. A minority of embryos have abnormal hearts and pericardial enema. Yolk sac vessels are pale. All embryos are dying by E12.5.

Show the 3 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences GATCTCGGAGAGCAGTGTAA and GTATTGTGATGTGTGAGAGG that targeted exon(s) ENSMUSE00000339408.2 ENSMUSE00000382653.2. This resulted in deletion(s) of 2893 bp (location: Chr7:46647018-46649910; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Inheritance:    Not Specified
Strategy for the generation of the Spty2d1em1(IMPC)J allele.
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 30 assay results
In Structures Affected by this Mutation: 6 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Spty2d1 Mutation:  28 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory