Spty2d1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Spty2d1^em1(IMPC)J
• Name: SPT2 chromatin protein domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6294149
• Synonyms: Spty2d1^-
• Gene: Spty2d1 Location: Chr7:46640144-46658159 bp, - strand Genetic Position: Chr7, 30.66 cM
• Alliance: Spty2d1^em1(IMPC)J page
• IMPC: Spty2d1 gene page

Spty2d1^em1(IMPC)J/Spty2d1^em1(IMPC)J (-/-) embryonic phenotype. Embryos are smaller, some have abnormally shaped heads and abnormal blood pooling. By E11.5, some start dying and those alive show abnormal blood pooling in and near the heart. A minority of embryos have abnormal hearts and pericardial enema. Yolk sac vessels are pale. All embryos are dying by E12.5.

Show the 3 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

Allele Type: Endonuclease-mediated (Null/knockout) Mutation: Intragenic deletion Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences GATCTCGGAGAGCAGTGTAA and GTATTGTGATGTGTGAGAGG that targeted exon(s) ENSMUSE00000339408.2 ENSMUSE00000382653.2. This resulted in deletion(s) of 2893 bp (location: Chr7:46647018-46649910; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794) Inheritance: Not Specified

Strategy for the generation of the Spty2d1^em1(IMPC)J allele.

Expression

In Mice Carrying this Mutation:	30 assay results
In Structures Affected by this Mutation:	6 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Spty2d1 Mutation: 28 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)