Spty2d1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Spty2d1^em1(IMPC)J
• Name: SPT2 chromatin protein domain containing 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6294149
• Synonyms: Spty2d1^-
• Gene: Spty2d1 Location: Chr7:46640144-46658159 bp, - strand Genetic Position: Chr7, 30.66 cM
• Alliance: Spty2d1^em1(IMPC)J page
• IMPC: Spty2d1 gene page

Spty2d1^em1(IMPC)J/Spty2d1^em1(IMPC)J (-/-) embryonic phenotype. Embryos are smaller, some have abnormally shaped heads and abnormal blood pooling. By E11.5, some start dying and those alive show abnormal blood pooling in and near the heart. A minority of embryos have abnormal hearts and pericardial enema. Yolk sac vessels are pale. All embryos are dying by E12.5.

Show the 3 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

Allele Type: Endonuclease-mediated (Null/knockout) Mutation: Intragenic deletion Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTATTGTGATGTGTGAGAGG and GATCTCGGAGAGCAGTGTAA, which resulted in a 2893 bp deletion beginning at Chromosome 7 position 46,997,270 bp and ending after 47,000,162 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000382653 and ENSMUSE00000339408 (exons 2 and 3) and 1245 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 20 and early truncation 83 amino acids later. (J:188991) Inheritance: Not Specified

Strategy for the generation of the Spty2d1^em1(IMPC)J allele.

Expression

In Mice Carrying this Mutation:	30 assay results
In Structures Affected by this Mutation:	7 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Spty2d1 Mutation: 26 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)