About   Help   FAQ
Spty2d1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Spty2d1em1(IMPC)J
Name: SPT2 chromatin protein domain containing 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6294149
Synonyms: Spty2d1-
Gene: Spty2d1  Location: Chr7:46640144-46658159 bp, - strand  Genetic Position: Chr7, 30.66 cM
Alliance: Spty2d1em1(IMPC)J page
IMPC: Spty2d1 gene page
Spty2d1em1(IMPC)J/Spty2d1em1(IMPC)J (-/-) embryonic phenotype. Embryos are smaller, some have abnormally shaped heads and abnormal blood pooling. By E11.5, some start dying and those alive show abnormal blood pooling in and near the heart. A minority of embryos have abnormal hearts and pericardial enema. Yolk sac vessels are pale. All embryos are dying by E12.5.

Show the 3 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTATTGTGATGTGTGAGAGG and GATCTCGGAGAGCAGTGTAA, which resulted in a 2893 bp deletion beginning at Chromosome 7 position 46,997,270 bp and ending after 47,000,162 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000382653 and ENSMUSE00000339408 (exons 2 and 3) and 1245 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 20 and early truncation 83 amino acids later. (J:188991)
Inheritance:    Not Specified
Strategy for the generation of the Spty2d1em1(IMPC)J allele.
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 30 assay results
In Structures Affected by this Mutation: 7 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Spty2d1 Mutation:  28 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/07/2026
MGI 6.24
The Jackson Laboratory