Bltp2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Bltp2^em1(IMPC)J
• Name: bridge-like lipid transfer protein family member 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6203636
• Synonyms: Bltp2^-
• Gene: Bltp2 Location: Chr11:78152578-78181449 bp, + strand Genetic Position: Chr11, 46.74 cM, cytoband B5
• Alliance: Bltp2^em1(IMPC)J page
• IMPC: Bltp2 gene page

Bltp2^em1(IMPC)J/Bltp2^em1(IMPC)J embryos alive at E10.5 exhibit heart defects and some have abnormal head shape and blood pooling. All mutants recovered at E11.5 are smaller and most are abnormal although a few appear normal.

Show the 4 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

Allele Type: Endonuclease-mediated (Null/knockout) Mutation: Intragenic deletion Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGAATCAAAAAGGGTAGA and CCAGTTGTTTCAAGTGTTTA, which resulted in a 414 bp deletion beginning at Chromosome 11 position 78,262,661 bp and ending after 78,263,074 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001295751 (exon 2) and 284 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 23 and early truncation 60 amino acids later. (J:188991) Inheritance: Not Specified

Strategy for the generation of the Bltp2^em1(IMPC)J allele.

Expression

In Mice Carrying this Mutation:	36 assay results
In Structures Affected by this Mutation:	6 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Bltp2 Mutation: 79 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)