About   Help   FAQ
Alg3em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Alg3em1(IMPC)J
Name: ALG3 alpha-1,3- mannosyltransferase; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6194900
Synonyms: Alg3-
Gene: Alg3  Location: Chr16:20424208-20429515 bp, - strand  Genetic Position: Chr16, 12.48 cM
Alliance: Alg3em1(IMPC)J page
IMPC: Alg3 gene page
Alg3em1(IMPC)J/Alg3em1(IMPC)J (-/-) embryos are smaller by E9.5 and and show developmental delay by E10.5, with abnormal head shape, and cardiac defects.

Show the 4 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AACTGGCCCTGGCCTGAAGT, GTTCACCCAGAGAATGCCGT, CAGGTTTGGGGAGCTGACGT and AGAGATTCTACCTCATTCCC, which resulted in a 536 bp deletion beginning at Chromosome 16 position 20,608,702 bp and ending after 20,609,237 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000314958, ENSMUSE00001226643, and ENSMUSE00001255837 (exons 2,3,4) and 127 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 65 and early truncation 5 amino acids later. (J:188991, J:384794)
Inheritance:    Not Specified
Strategy for the generation of the Alg3em1(IMPC)J allele.
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 57 assay results
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Alg3 Mutation:  15 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  6 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/09/2026
MGI 6.24
The Jackson Laboratory