Stt3b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Stt3b^em1(IMPC)J
• Name: STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6188000
• Synonyms: Stt3b^-
• Gene: Stt3b Location: Chr9:115071649-115139489 bp, - strand Genetic Position: Chr9, 67.71 cM, cytoband F3
• Alliance: Stt3b^em1(IMPC)J page
• IMPC: Stt3b gene page

Stt3b^em1(IMPC)J/Stt3b^em1(IMPC)J (-/-) embryos at E9.5 are often small and occasionally show cardiac or pericardial edema. E10.5 mutants are developmentally delayed, show abnormal heart and yolk sac morphology, and abnormal heart shape and branchial arches.

Show the 2 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

Allele Type: Endonuclease-mediated (Null/knockout) Mutation: Intragenic deletion Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CATTTCCTGCTAAGGGACGA, ACAGTAGTAGCCTCTTCACA, TTGAGTTTAAAAGCTTTTGG and TTTTAACAGACAAAAGTGAA, which resulted in a 633 bp deletion beginning at Chromosome 9 position 115,280,019 bp and ending after 115,280,651 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000219753 (exon 2) and 524 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 103 and early truncation 3 amino acids later. (J:188991) Inheritance: Not Specified

Strategy for the generation of the Stt3b^em1(IMPC)J allele.

Expression

In Mice Carrying this Mutation:	24 assay results
In Structures Affected by this Mutation:	7 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Stt3b Mutation: 39 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)