Pgm1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Pgm1em1(IMPC)J |
| Name: |
phosphoglucomutase 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6157346 |
| Synonyms: |
Pgm1- |
| Gene: |
Pgm1 Location: Chr4:99786648-99844491 bp, + strand Genetic Position: Chr4, 45.71 cM
|
| Alliance: |
Pgm1em1(IMPC)J page
|
| IMPC: |
Pgm1 gene page |
|
Pgm1em1(IMPC)J/Pgm1em1(IMPC)J embryos are developmentally delayed, and exhibit abnormal heart morphology and branchial arches. By E10.5, embryos are dying.
Show the 3 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTCCCACGAAGAAATGCCA, CTGATTCCCATCTTAAGAAG, TGTGACAGTCCATCTGGGGA and GCTACAATTCATTACAAAGA, which resulted in a 521 bp deletion beginning at Chromosome 4 position 99,961,333 bp and ending after 99,961,853 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001083174 (exon 2) and 358 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 82 and early truncation 26 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
Strategy for the generation of the Pgm1em1(IMPC)J allele. |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|