About   Help   FAQ
Cdk12em1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Cdk12em1(IMPC)Tcp
Name: cyclin dependent kinase 12; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:5754588
Gene: Cdk12  Location: Chr11:98093885-98169330 bp, + strand  Genetic Position: Chr11, 61.75 cM, cytoband D
Alliance: Cdk12em1(IMPC)Tcp page
IMPC: Cdk12 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele, from project TCPR0385, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences CAATGGTTATCATAGAATTC, GTAAGAAGCCAATTGTGTAA, GCCTTATATTTCAGAGGTTC, and TGCACTACACTTTATCAAAA. This resulted in a 939-bp del Chr11:98220860 to 98221798_insC (GRCm38). (J:165963)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 5 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cdk12 Mutation:  74 strains or lines available
References
Original:  J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory