Cdk12^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cdk12^em1(IMPC)Tcp
• Name: cyclin dependent kinase 12; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:5754588
• Gene: Cdk12 Location: Chr11:98093885-98169330 bp, + strand Genetic Position: Chr11, 61.75 cM, cytoband D
• Alliance: Cdk12^em1(IMPC)Tcp page
• IMPC: Cdk12 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele, from project TCPR0385, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences CAATGGTTATCATAGAATTC, GTAAGAAGCCAATTGTGTAA, GCCTTATATTTCAGAGGTTC, and TGCACTACACTTTATCAAAA. This resulted in a 939-bp del Chr11:98220860 to 98221798_insC (GRCm38). (J:165963)

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cdk12 Mutation: 75 strains or lines available

References

• Original: J:165963 Centre for Modeling Human Disease, Alleles produced for the NorCOMM project by the Centre for Modeling Human Disease (Cmhd), Institute of Biomaterials & Biomedical Engineering, University of Toronto. MGI Direct Data Submission. 2010
• All: 3 reference(s)