About   Help   FAQ
Mouse SNPs
Query Results -- Summary
 Symbol
Name
ID
F9
coagulation factor IX
MGI:88384

336 matching SNPs displayed
Full result set is also available in a tab-delimited format.


Legend
 Results are sorted by chromosome/coordinate value. Chromosome transitions are marked by blank rows.
SNP ID
(dbSNP Build 137)
Map Position
(GRCm38)
Gene : dbSNP Function ClassAssays
(ss)
Variation
Type
Allele
Summary
(all strains)
rs16814502
MPD | dbSNP | MGI SNP Detail
ChrX:59997696rF9 : Locus-Region1SNP AAAAAAAA   AAGAAA AA  AAAA A  A/G
rs16814501
MPD | dbSNP | MGI SNP Detail
ChrX:59997810rF9 : Locus-Region1SNP GGGGGGGG   GGAGGG GG  GGGG G  A/G
rs16814500
MPD | dbSNP | MGI SNP Detail
ChrX:59997894rF9 : Locus-Region2SNPCCCCCCCTCCTCCCTCCCCCCC CTCCCCTCC/T
rs16814499
MPD | dbSNP | MGI SNP Detail
ChrX:59997995rF9 : Locus-Region2SNPTTTTTTTCTTCT TCTTTTTTT TCTTT CTC/T
rs16814498
MPD | dbSNP | MGI SNP Detail
ChrX:59998025rF9 : Locus-Region2SNPGGGGGGGCGGGG GGG GG  G GG GG GGC/G
rs16814477
MPD | dbSNP | MGI SNP Detail
ChrX:59998211rF9 : Locus-Region2SNPTTTTTTTCTTCTTTCTTTTTTTTTCTTTTC C/T
rs16814476
MPD | dbSNP | MGI SNP Detail
ChrX:59998276rF9 : Locus-Region1SNP CCCCCCTC   CCCCCC CC CCTCC C  C/T
rs16814475
MPD | dbSNP | MGI SNP Detail
ChrX:59998546rF9 : Locus-Region2SNPAAAAAAAAAAGAAAAAAA AAAAAGAAAAG A/G
rs29056277
MPD | dbSNP | MGI SNP Detail
ChrX:59998585fF9 : Locus-Region1SNPTTTT T GTTGT      T  T     T GTG/T
rs16814474
MPD | dbSNP | MGI SNP Detail
ChrX:59998649rF9 : Locus-Region2SNPAAAAAAAGAA AAAAAAAAAAAAAGAAAAGAA/G
rs16814503
MPD | dbSNP | MGI SNP Detail
ChrX:59999276fF9 : Locus-Region1SNP GGGGGGGG   GGCGGG GG GGGGG G  C/G
rs16814504
MPD | dbSNP | MGI SNP Detail
ChrX:59999288fF9 : Locus-Region1SNP GGGGGGGG   GGAGGG GG GGGGG G  A/G
rs16814505
MPD | dbSNP | MGI SNP Detail
ChrX:59999349fF9 : Locus-Region1SNP CCCCCCCC   CCTCCC CC CCCCC C  C/T
rs16814506
MPD | dbSNP | MGI SNP Detail
ChrX:59999421fF9 : Locus-Region1SNP GGGGGGGG   GGAGGG GG GGGGG G  A/G
rs16814507
MPD | dbSNP | MGI SNP Detail
ChrX:59999677fF9 : Intron2SNPAAAAAAACAACAAACAAAAAAAAACAAAACAA/C
rs31739694
MPD | dbSNP | MGI SNP Detail
ChrX:59999736fF9 : Intron1SNPCCCC C TCCCC      C  C     C CCC/T
rs16814508
MPD | dbSNP | MGI SNP Detail
ChrX:59999814fF9 : Intron2SNPAAAAAAAGAAGAAAGAAAAAAA AGAAAAGGA/G
rs31738483
MPD | dbSNP | MGI SNP Detail
ChrX:59999856fF9 : Intron1SNPGGGG G AGGGG      G  G     G GGA/G
rs29056276
MPD | dbSNP | MGI SNP Detail
ChrX:60000131fF9 : Intron1SNPTTTT T CTTCT      T  T     T CTC/T
rs31738482
MPD | dbSNP | MGI SNP Detail
ChrX:60000217fF9 : Intron1SNPGGGG G AGGGG         G     G GGA/G
rs29056275
MPD | dbSNP | MGI SNP Detail
ChrX:60000381fF9 : Intron1SNPGGGG G GGGAG      G  G     G GGA/G
rs16814856
MPD | dbSNP | MGI SNP Detail
ChrX:60000498rF9 : Intron2SNPCCCCCCCTCCTCCCCCCCCCCCCCTCCCCTCC/T
rs16814855
MPD | dbSNP | MGI SNP Detail
ChrX:60000566rF9 : Intron2SNPCCCCCCCACCACCCCCCCCCCCCCACCCCACA/C
rs16814854
MPD | dbSNP | MGI SNP Detail
ChrX:60000667rF9 : Intron2SNPTTTTTTTCTTCTTTTTTTTTTTTTCTTTTCTC/T
rs29055932
MPD | dbSNP | MGI SNP Detail
ChrX:60000721fF9 : Intron1SNPCCCC C CCCCC      C  C     C GCC/G
SNP ID
(dbSNP Build 137)
Map Position
(GRCm38)
Gene : dbSNP Function ClassAssays
(ss)
Variation
Type
Allele
Summary
(all strains)
rs29055931
MPD | dbSNP | MGI SNP Detail
ChrX:60000724fF9 : Intron1SNPGGGG G AGGGG      G  G     G GGA/G
rs29055930
MPD | dbSNP | MGI SNP Detail
ChrX:60000824fF9 : Intron1SNPCCCC C TCCTC      C  C     C TCC/T
rs16814512
MPD | dbSNP | MGI SNP Detail
ChrX:60000879rF9 : Intron1SNP GGGGGGGG   GGCGGG G  GGGGG G  C/G
rs16814511
MPD | dbSNP | MGI SNP Detail
ChrX:60000890rF9 : Intron1SNP CCCCCCCC   CCTCCC CC CCCCC C  C/T
rs16814510
MPD | dbSNP | MGI SNP Detail
ChrX:60000920rF9 : Intron1SNP TTTTTTTT   TTCTTT T  TTTTT T  C/T
rs16814509
MPD | dbSNP | MGI SNP Detail
ChrX:60000922rF9 : Intron1SNP TTTTTT T   TTTTTT T  TTATT T  A/T
rs29055929
MPD | dbSNP | MGI SNP Detail
ChrX:60000943fF9 : Intron1SNPCCCC C CCCCC      C  C     C TCC/T
rs16814706
MPD | dbSNP | MGI SNP Detail
ChrX:60001027rF9 : Intron2SNPCCCCCCCGCCGCCCCCCCC CC C CCCCGCC/G
rs16814705
MPD | dbSNP | MGI SNP Detail
ChrX:60001059rF9 : Intron1SNP CCCCCCTC   CCTCCC CC  C CC C  C/T
rs16814704
MPD | dbSNP | MGI SNP Detail
ChrX:60001076rF9 : Intron2SNPAAAAAAAGAA AAAGAAAAAAA A AAAA AA/G
rs16814703
MPD | dbSNP | MGI SNP Detail
ChrX:60001101rF9 : Intron1SNP GGGGGGGG   GGTGGG GG  G GG G  G/T
rs16814702
MPD | dbSNP | MGI SNP Detail
ChrX:60001142rF9 : Intron2SNPCCCCCCCTCCTCCCCCCCCCCC C CCCCTCC/T
rs16814701
MPD | dbSNP | MGI SNP Detail
ChrX:60001150rF9 : Intron2SNPCCCCCCCTCC CCCTCCCCCCC C CCCCTCC/T
rs31738481
MPD | dbSNP | MGI SNP Detail
ChrX:60001183fF9 : Intron1SNPGGGG G AGGGG      G  G     G GGA/G
rs16814700
MPD | dbSNP | MGI SNP Detail
ChrX:60001209rF9 : Intron1SNP CCCCCCCC   CCGCCC CC  C CC C  C/G
rs16814699
MPD | dbSNP | MGI SNP Detail
ChrX:60001283rF9 : Intron2SNPTTTTTTTCTTCTTTCTTTTTTT T TTTT TC/T
rs16814698
MPD | dbSNP | MGI SNP Detail
ChrX:60001299rF9 : Intron1SNP GGGGGGCG   GGCGGG GG  G GG G  C/G
rs16814697
MPD | dbSNP | MGI SNP Detail
ChrX:60001343rF9 : Intron1SNP GGGGGGGG   GGAGGG GG  G GG G  A/G
rs16814696
MPD | dbSNP | MGI SNP Detail
ChrX:60001367rF9 : Intron1SNP TTTTTTCT   TTTTTT TT  T TT T  C/T
rs16814695
MPD | dbSNP | MGI SNP Detail
ChrX:60001429rF9 : Intron1SNP GGGGGGAG   GGGGGG GG  G GG G  A/G
rs16814694
MPD | dbSNP | MGI SNP Detail
ChrX:60001434rF9 : Intron1SNP GGGGGGCG   GGGGGG GG  G GG G  C/G
rs16814693
MPD | dbSNP | MGI SNP Detail
ChrX:60001454rF9 : Intron1SNP TTTTTTCT   TTTTTT TT  T TT T  C/T
rs16814692
MPD | dbSNP | MGI SNP Detail
ChrX:60001552rF9 : Intron1SNP GGGGGGA    GGGGGG     G GG G  A/G
rs16814521
MPD | dbSNP | MGI SNP Detail
ChrX:60001695rF9 : Intron1SNP GGGGGGAG   GGGGGG G  GGAGG    A/G
rs16814520
MPD | dbSNP | MGI SNP Detail
ChrX:60001748rF9 : Intron1SNP CCCCCCCC   CCCCCC C  CCT C    C/T
SNP ID
(dbSNP Build 137)
Map Position
(GRCm38)
Gene : dbSNP Function ClassAssays
(ss)
Variation
Type
Allele
Summary
(all strains)
rs16814519
MPD | dbSNP | MGI SNP Detail
ChrX:60001749rF9 : Intron1SNP AAAAAAAA    AGAAA A  AAA A    A/G
rs16814518
MPD | dbSNP | MGI SNP Detail
ChrX:60001834rF9 : Intron1SNP CCCCCCCC    CGCC  C  CCC C    C/G
rs16814517
MPD | dbSNP | MGI SNP Detail
ChrX:60001846rF9 : Intron1SNP AAAAAAAA    AGAAA A  AAA A    A/G
rs29055928
MPD | dbSNP | MGI SNP Detail
ChrX:60002018fF9 : Intron1SNPTTTT T GTTGT      T  T     T GTG/T
rs29055927
MPD | dbSNP | MGI SNP Detail
ChrX:60002112fF9 : Intron1SNPTTTT T TTT T      T  T     T TCC/T
rs29055926
MPD | dbSNP | MGI SNP Detail
ChrX:60002114fF9 : Intron1SNPGGGG G TGGTG      G  G     G TGG/T
rs29055925
MPD | dbSNP | MGI SNP Detail
ChrX:60002179fF9 : Intron1SNPGGGG G AGGAG      G  G     G AGA/G
rs29055924
MPD | dbSNP | MGI SNP Detail
ChrX:60002241fF9 : Intron1SNPAAAA A GAAGA      A  A     A GAA/G
rs29055683
MPD | dbSNP | MGI SNP Detail
ChrX:60002374fF9 : Intron1SNPGGGG G AGGAG      G  G     G AGA/G
rs29055682
MPD | dbSNP | MGI SNP Detail
ChrX:60002416fF9 : Intron1SNPGGGG G AGGAG      G  G     G AAA/G
rs29055681
MPD | dbSNP | MGI SNP Detail
ChrX:60002453fF9 : Intron1SNPTTTT T CTTCT      T  T     T CTC/T
rs29055680
MPD | dbSNP | MGI SNP Detail
ChrX:60002574fF9 : Intron1SNPGGGG G AGGAG      G  G     G AGA/G
rs29055679
MPD | dbSNP | MGI SNP Detail
ChrX:60002616fF9 : Intron1SNPCCCC C CCCTC      C  C     C TCC/T
rs29055678
MPD | dbSNP | MGI SNP Detail
ChrX:60002686fF9 : Intron1SNPGGGG G AGGAG      G  G     G AGA/G
rs16814711
MPD | dbSNP | MGI SNP Detail
ChrX:60002828rF9 : Intron1SNP CCCCCCTC   CCTCCC CC CCTCC C  C/T
rs16814710
MPD | dbSNP | MGI SNP Detail
ChrX:60002983rF9 : Intron1SNP TTTTTTTT   TTATTT TT TTTTT T  A/T
rs16814709
MPD | dbSNP | MGI SNP Detail
ChrX:60003066rF9 : Intron2SNPCCCCCCCTCCCCCCCCCCCCCCCCCCCCCCCC/T
rs16814708
MPD | dbSNP | MGI SNP Detail
ChrX:60003139rF9 : Intron1SNP CCCCCCCC   CCTCCC CC CCCCC C  C/T
rs16814707
MPD | dbSNP | MGI SNP Detail
ChrX:60003174rF9 : Intron1SNP CCCCCC C   CCTCCC CC CC CC C  C/T
rs29055677
MPD | dbSNP | MGI SNP Detail
ChrX:60003457fF9 : Intron1SNPAAAA A GAA A      A  A     A  GA/G
rs29055676
MPD | dbSNP | MGI SNP Detail
ChrX:60003458fF9 : Intron1SNPCCCC C CCCTC      C  C     C TCC/T
rs16814712
MPD | dbSNP | MGI SNP Detail
ChrX:60003567rF9 : Intron1SNP        A     G          A     A/G
rs31738480
MPD | dbSNP | MGI SNP Detail
ChrX:60003820fF9 : Intron1SNP A     G A                 A A A/G
rs29055675
MPD | dbSNP | MGI SNP Detail
ChrX:60003850fF9 : Coding-Synonymous1SNPTTTT T CTTCT      T  T     T CTC/T
rs29055674
MPD | dbSNP | MGI SNP Detail
ChrX:60004386fF9 : Intron1SNPCCCC C CCCCC      C  C     C CTC/T
SNP ID
(dbSNP Build 137)
Map Position
(GRCm38)
Gene : dbSNP Function ClassAssays
(ss)
Variation
Type
Allele
Summary
(all strains)
rs29055353
MPD | dbSNP | MGI SNP Detail
ChrX:60004702fF9 : Intron1SNPCCCC C CCCTC      C  C     C TCC/T
rs29055352
MPD | dbSNP | MGI SNP Detail
ChrX:60004823fF9 : Intron1SNPGGGG G GGGGG      G  G     G GTG/T
rs29055351
MPD | dbSNP | MGI SNP Detail
ChrX:60004842fF9 : Intron1SNPTTTT T TTTTT      T  T     T TAA/T
rs31738479
MPD | dbSNP | MGI SNP Detail
ChrX:60004886fF9 : Intron1SNPCCCC C TCCCC      C  C     C CCC/T
rs29055350
MPD | dbSNP | MGI SNP Detail
ChrX:60005356fF9 : Intron1SNPTTTT T GTTGT      T  T     T GGG/T
rs29055349
MPD | dbSNP | MGI SNP Detail
ChrX:60005579fF9 : Intron1SNPCCCC C CCCCC      C  C     C CTC/T
rs29055348
MPD | dbSNP | MGI SNP Detail
ChrX:60005654fF9 : Intron1SNP AAA A AAA A         A     A  GA/G
rs29055347
MPD | dbSNP | MGI SNP Detail
ChrX:60005657fF9 : Intron1SNP TTT T TTTGT         T     T G G/T
rs16814534
MPD | dbSNP | MGI SNP Detail
ChrX:60006209rF9 : Intron1SNP GGGGGGGG   GGGGGG GG GGAGG G  A/G
rs16814533
MPD | dbSNP | MGI SNP Detail
ChrX:60006222rF9 : Intron1SNP GG GGGGG   GGAGGG GG GG GG G  A/G
rs16814532
MPD | dbSNP | MGI SNP Detail
ChrX:60006224rF9 : Intron1SNP AAAAAACA   AAAAAA AA AA AA A  A/C
rs16814531
MPD | dbSNP | MGI SNP Detail
ChrX:60006228rF9 : Intron1SNP AAAAAACA   AAAAAA AA AA AA A  A/C
rs16814530
MPD | dbSNP | MGI SNP Detail
ChrX:60006232rF9 : Intron1Mixed AA AAACA   AAAAAA AA AA-AA A  -/A/C
rs16814529
MPD | dbSNP | MGI SNP Detail
ChrX:60006400rF9 : Intron1SNP GGGGGGAG   GGGGGG GG GGGGG G  A/G
rs16814528
MPD | dbSNP | MGI SNP Detail
ChrX:60006471rF9 : Intron1SNP CCCC CCC   CCTCCC CC CCCCC C  C/T
rs16814527
MPD | dbSNP | MGI SNP Detail
ChrX:60006494rF9 : Intron1SNP TTTT TTT   TTCTTT TT TTTTT T  C/T
rs16814526
MPD | dbSNP | MGI SNP Detail
ChrX:60006544rF9 : Intron1SNP GGGG GGG   GGAGGG GG GGGGG G  A/G
rs16814525
MPD | dbSNP | MGI SNP Detail
ChrX:60006552rF9 : Intron1SNP TTTT TCT   TTCTTT TT TTCTT T  C/T
rs16814524
MPD | dbSNP | MGI SNP Detail
ChrX:60006622rF9 : Intron1IN-DEL TTTT TTT   TT-TTT TT T TTT T  -/T
rs16814523
MPD | dbSNP | MGI SNP Detail
ChrX:60006623rF9 : Intron1IN-DEL CCCC CCC   CC-CCC CC C CCC C  -/C
rs16814522
MPD | dbSNP | MGI SNP Detail
ChrX:60006624rF9 : Intron1IN-DEL TTTT TTT   TT-TTT TT T TTT T  -/T
rs31738478
MPD | dbSNP | MGI SNP Detail
ChrX:60006791fF9 : Intron1SNP A     AGAG                  G A/G
rs16814535
MPD | dbSNP | MGI SNP Detail
ChrX:60006812fF9 : Intron1SNP T    A A   T AT   AA   ATT    A/T
rs16814536
MPD | dbSNP | MGI SNP Detail
ChrX:60006835fF9 : Intron1SNP GGGGGGGG   GGTGGG    GGGGG G  G/T
rs16814537
MPD | dbSNP | MGI SNP Detail
ChrX:60006888fF9 : Intron1SNP TTTTTTTT   TTGTTT  T TTTTT T  G/T
SNP ID
(dbSNP Build 137)
Map Position
(GRCm38)
Gene : dbSNP Function ClassAssays
(ss)
Variation
Type
Allele
Summary
(all strains)
rs16814538
MPD | dbSNP | MGI SNP Detail
ChrX:60006972fF9 : Intron1SNP AAAAAAAA   AAGAAA    AAAAA A  A/G
rs16814539
MPD | dbSNP | MGI SNP Detail
ChrX:60007030fF9 : Intron1SNP GGGGGGAG   GGGGGG    GGGGG G  A/G
rs16814540
MPD | dbSNP | MGI SNP Detail
ChrX:60007037fF9 : Intron1SNP CCCCCCAC   CCCCCC    CCCCC C  A/C
rs16814541
MPD | dbSNP | MGI SNP Detail
ChrX:60007056fF9 : Intron1SNP TTTTTTTT   TTGTTT TT TTTTT T  G/T
rs16814567
MPD | dbSNP | MGI SNP Detail
ChrX:60007344rF9 : Intron1SNP AAAAAAAA   AAGAAA AA AAAAA A  A/G
rs16814566
MPD | dbSNP | MGI SNP Detail
ChrX:60007347rF9 : Intron1SNP AAAAAAAA   AAGAAA AA AAAAA A  A/G
rs16814565
MPD | dbSNP | MGI SNP Detail
ChrX:60007354rF9 : Intron1SNP CCCCCCCC   CCTCCC CC CCCCC C  C/T
rs16814564
MPD | dbSNP | MGI SNP Detail
ChrX:60007366rF9 : Intron1SNP CCCCCCCC   CCTCCC CC CCCCC C  C/T
rs16814563
MPD | dbSNP | MGI SNP Detail
ChrX:60007373rF9 : Intron1SNP GGGGGGGG   GGAGGG GG GGGGG G  A/G
rs16814562
MPD | dbSNP | MGI SNP Detail
ChrX:60007383rF9 : Intron1SNP CCCCCCCC   CCTCCC CC CCCCC C  C/T
rs16814561
MPD | dbSNP | MGI SNP Detail
ChrX:60007440rF9 : Intron2SNPTTTTTTTCTTCTTTCTTTTTTTTTCTTTTCCC/T
rs16814560
MPD | dbSNP | MGI SNP Detail
ChrX:60007496rF9 : Intron1SNP GGGGGGGG   GGAGGG GG GGGGG G  A/G
rs16814559
MPD | dbSNP | MGI SNP Detail
ChrX:60007499rF9 : Intron2SNPTTTTTTTTTTCTTTTTTTTTTTTTCTTTTCTC/T
rs16814558
MPD | dbSNP | MGI SNP Detail
ChrX:60007510rF9 : Intron1SNP TTTTTTTT   TTATTT TT TTTTT T  A/T
rs16814557
MPD | dbSNP | MGI SNP Detail
ChrX:60007525rF9 : Intron1SNP AAAAAAAA   AAGAAA AA AAAAA A  A/G
rs16814556
MPD | dbSNP | MGI SNP Detail
ChrX:60007568rF9 : Intron1SNP TTTTTTTT   TTATTT TT TTTTT T  A/T
rs29055346
MPD | dbSNP | MGI SNP Detail
ChrX:60007668fF9 : Intron1SNPGGGG G GGGGG      G  G     G GTG/T
rs16814555
MPD | dbSNP | MGI SNP Detail
ChrX:60007683rF9 : Intron1SNP CCCCCCCC   CCTCCC CC CCCCC C  C/T
rs16814554
MPD | dbSNP | MGI SNP Detail
ChrX:60007690rF9 : Intron1SNP TTTTTTTT   TTATTT TT TTTTT T  A/T
rs16814553
MPD | dbSNP | MGI SNP Detail
ChrX:60007711rF9 : Intron1SNP TTTTTTTT   TTCTTT TT TTTTT T  C/T
rs16814546
MPD | dbSNP | MGI SNP Detail
ChrX:60007747rF9 : Intron7Mixed --------   --A--- -- ----- -  -/A/C/G/T
rs16814545
MPD | dbSNP | MGI SNP Detail
ChrX:60007799rF9 : Intron1SNP GGGGGGGG   GGAGGG GG GGGGG G  A/G
rs16814544
MPD | dbSNP | MGI SNP Detail
ChrX:60007802rF9 : Intron1SNP GGGGGGGG   GGGGGG GG GGAGG G  A/G
rs16814543
MPD | dbSNP | MGI SNP Detail
ChrX:60007824rF9 : Intron1SNP GGGGGGGG   GGGGGG GG GGAGG G  A/G
rs16814542
MPD | dbSNP | MGI SNP Detail
ChrX:60007827rF9 : Intron1SNP TTTTTTTT   TTGTTT TT TTTTT T  G/T
SNP ID
(dbSNP Build 137)
Map Position
(GRCm38)
Gene : dbSNP Function ClassAssays
(ss)
Variation
Type
Allele
Summary
(all strains)
rs16814714
MPD | dbSNP | MGI SNP Detail
ChrX:60008108rF9 : Intron1SNP AAAAAATA   A  AAA AA  A AA A  A/T
rs31136912
MPD | dbSNP | MGI SNP Detail
ChrX:60008158fF9 : Intron1SNP G    C                        C/G
rs16814713
MPD | dbSNP | MGI SNP Detail
ChrX:60008304rF9 : Intron1SNP CCCCCCTC   C  CCC CC  C CC C  C/T
rs31738477
MPD | dbSNP | MGI SNP Detail
ChrX:60008427fF9 : Intron1SNPAAAA A TAAAA      A  A     A AAA/T
rs16814481
MPD | dbSNP | MGI SNP Detail
ChrX:60008509rF9 : Intron2SNPAAAAAAAGAAGAAAGAAAAAAAAAGAAAAGGA/G
rs16814480
MPD | dbSNP | MGI SNP Detail
ChrX:60008511rF9 : Intron1SNP AAAAAAAA   AAGAAA AA AAAAA A  A/G
rs16814479
MPD | dbSNP | MGI SNP Detail
ChrX:60008527rF9 : Intron1SNP CCCCCCCC   CCGCCC CC CCCCC C  C/G
rs16814478
MPD | dbSNP | MGI SNP Detail
ChrX:60008990rF9 : Intron1SNP AAAAA AA   AAGAAA    AAAAA    A/G
rs29055344
MPD | dbSNP | MGI SNP Detail
ChrX:60009321fF9 : Intron1SNPGGGG   AGGAG         G     G AAA/G
rs31738476
MPD | dbSNP | MGI SNP Detail
ChrX:60009414fF9 : Intron1SNPCCCC C ACCCC      C  C     C CCA/C
rs16814489
MPD | dbSNP | MGI SNP Detail
ChrX:60009635rF9 : Intron1SNP AAAAAAAA   AAGAAA AA AAAAA A  A/G
rs16814488
MPD | dbSNP | MGI SNP Detail
ChrX:60009689rF9 : Intron1SNP TTTTTTTT   TTCTTT TT TTTTT T  C/T
rs16814487
MPD | dbSNP | MGI SNP Detail
ChrX:60009786rF9 : Intron1SNP TTTTTTTT   TTCTTT TT TTTTT T  C/T
rs16814486
MPD | dbSNP | MGI SNP Detail
ChrX:60009877rF9 : Intron2SNPAAAAAAAGAAGAAAAAAAAAAAAAGAAAAGAA/G
rs16814485
MPD | dbSNP | MGI SNP Detail
ChrX:60009898rF9 : Intron1SNP GGGGGGGG   GGAGGG GG GGGGG G  A/G
rs16814484
MPD | dbSNP | MGI SNP Detail
ChrX:60009927rF9 : Intron1SNP AAAAAAAA   AATAAA AA AAAAA A  A/T
rs16814483
MPD | dbSNP | MGI SNP Detail
ChrX:60009941rF9 : Intron1SNP CCCCCCTC   CCCCCC CC CCCCC C  C/T
rs16814482
MPD | dbSNP | MGI SNP Detail
ChrX:60010172rF9 : Intron2SNPCCCCCCCACCCCCC CCCCC CC  CCC CCA/C
rs16818689
MPD | dbSNP | MGI SNP Detail
ChrX:60010258rF9 : Intron1SNP     A                G A      A/G
rs16818688
MPD | dbSNP | MGI SNP Detail
ChrX:60010360rF9 : Intron1SNP AAAAAAGA   AA AAA AA AAGAA A  A/G
rs31738475
MPD | dbSNP | MGI SNP Detail
ChrX:60010399fF9 : Intron1SNPTTTT T CT CT         T     T CTC/T
rs16818687
MPD | dbSNP | MGI SNP Detail
ChrX:60010466rF9 : Intron2SNPGGGGGGGAGGAGGG GGGGGGGGG GGGGAGA/G
rs29057458
MPD | dbSNP | MGI SNP Detail
ChrX:60010497fF9 : Intron1SNPCCCC C CCCAC      C  C     C ACA/C
rs16818686
MPD | dbSNP | MGI SNP Detail
ChrX:60010628rF9 : Intron1SNP  A A  A    AG   G AA A GA  A  A/G
rs16818685
MPD | dbSNP | MGI SNP Detail
ChrX:60010656rF9 : Intron1SNP        T   T         T C   T  C/T
SNP ID
(dbSNP Build 137)
Map Position
(GRCm38)
Gene : dbSNP Function ClassAssays
(ss)
Variation
Type
Allele
Summary
(all strains)
rs16818684
MPD | dbSNP | MGI SNP Detail
ChrX:60010663rF9 : Intron1SNP     G      TG   G    T G      G/T
rs29057457
MPD | dbSNP | MGI SNP Detail
ChrX:60010950fF9 : Intron1SNPGGGG G GGGGG      G  G     G GAA/G
rs29057456
MPD | dbSNP | MGI SNP Detail
ChrX:60011178fF9 : Intron1SNPAAAA A GAAGA      A  A     A GAA/G
rs29057455
MPD | dbSNP | MGI SNP Detail
ChrX:60011444fF9 : Intron1SNPGGGG G AGGAG      G  G     G AGA/G
rs16814585
MPD | dbSNP | MGI SNP Detail
ChrX:60013536rF9 : Intron1IN-DEL TTTTTT-T   TTTTTT TT TTTTT T  -/T
rs16814584
MPD | dbSNP | MGI SNP Detail
ChrX:60013537rF9 : Intron1IN-DEL TTTTTT-T   TTTTTT TT TTTTT T  -/T
rs16814583
MPD | dbSNP | MGI SNP Detail
ChrX:60013538rF9 : Intron2SNPAAAAAAAAAAGAAAAAAAAAAAAAGAAAAGAA/G
rs16814582
MPD | dbSNP | MGI SNP Detail
ChrX:60013539rF9 : Intron1SNP TTTTTTCT   TTTTTT TT TTTTT T  C/T
rs16814718
MPD | dbSNP | MGI SNP Detail
ChrX:60013543rF9 : Intron1SNP GGGGGGAG   GGGGGG GG GGGGG G  A/G
rs16814717
MPD | dbSNP | MGI SNP Detail
ChrX:60013544rF9 : Intron1IN-DEL TTTTTT-T   TTTTTT TT TTTTT T  -/T
rs16814716
MPD | dbSNP | MGI SNP Detail
ChrX:60013546rF9 : Intron1IN-DEL AAAAAA-A   AAAAAA AA AAAAA A  -/A
rs16814715
MPD | dbSNP | MGI SNP Detail
ChrX:60013551rF9 : Intron1SNP TTTTTTCT   TTTTTT TT TTTTT T  C/T
rs16814589
MPD | dbSNP | MGI SNP Detail
ChrX:60014053rF9 : Intron1SNP CCCCCCCC   CCTCCC CC CCCCC C  C/T
rs16814588
MPD | dbSNP | MGI SNP Detail
ChrX:60014073rF9 : Intron1SNP GGGGGGGG   GGAGGG GG GGGGG G  A/G
rs16814587
MPD | dbSNP | MGI SNP Detail
ChrX:60014092rF9 : Intron1SNP TTTTTTTT   TTGTTT TT TTTTT T  G/T
rs16814586
MPD | dbSNP | MGI SNP Detail
ChrX:60014116rF9 : Intron2SNPGGGGGGGGGGCGGGAGGGGGGGGGCGGGGCGA/C/G
rs16814594
MPD | dbSNP | MGI SNP Detail
ChrX:60014399rF9 : Intron1SNP CCCCCCCC   CCACCC CC CCCCC C  A/C
rs16814593
MPD | dbSNP | MGI SNP Detail
ChrX:60014421rF9 : Intron1SNP GGGGGGGG   GGCGGG GG GGGGG G  C/G
rs16814592
MPD | dbSNP | MGI SNP Detail
ChrX:60014478rF9 : Intron2SNPTTTTTTTATTATTTATTTTTTTTTATTTTATA/T
rs16814591
MPD | dbSNP | MGI SNP Detail
ChrX:60014593rF9 : Intron1SNP CCCCCCCC   C TCCC CC CCCCC C  C/T
rs16814590
MPD | dbSNP | MGI SNP Detail
ChrX:60014716rF9 : Intron1SNP GGGGGGGG   G  GTG G    GGG G  G/T
rs31738474
MPD | dbSNP | MGI SNP Detail
ChrX:60014907fF9 : Intron1SNPGGGG G AGGGG      G  G     G GGA/G
rs31737053
MPD | dbSNP | MGI SNP Detail
ChrX:60014955fF9 : Intron1SNPGGGG G GGGCG      G  G     G CGC/G
rs31737052
MPD | dbSNP | MGI SNP Detail
ChrX:60014964fF9 : Intron1SNPAAAA A GAAGA      A  A     A GAA/G
rs31737051
MPD | dbSNP | MGI SNP Detail
ChrX:60015017fF9 : Intron1SNPTT T T CTT T      T  T     T CTC/T
SNP ID
(dbSNP Build 137)
Map Position
(GRCm38)
Gene : dbSNP Function ClassAssays
(ss)
Variation
Type
Allele
Summary
(all strains)
rs31737050
MPD | dbSNP | MGI SNP Detail
ChrX:60015313fF9 : Intron1SNPAAAA A GAA A      A  A     A  AA/G
rs31737049
MPD | dbSNP | MGI SNP Detail
ChrX:60016064fF9 : Intron1SNPGGGG G TGG G         G     G  GG/T
rs16814497
MPD | dbSNP | MGI SNP Detail
ChrX:60016696rF9 : Intron1SNP CCCCCCCC   CCGCCC CC CCCCC C  C/G
rs16814496
MPD | dbSNP | MGI SNP Detail
ChrX:60016713rF9 : Intron1SNP CCCCCCCC   CCTCCC CC CCCCC C  C/T
rs16814495
MPD | dbSNP | MGI SNP Detail
ChrX:60016792rF9 : Intron1SNP AAAAAAAA   AAGAAA AA AAAAA A  A/G
rs16814494
MPD | dbSNP | MGI SNP Detail
ChrX:60016829rF9 : Intron1SNP GGGGGGGG   GGAGGG GG GGGGG G  A/G
rs16814493
MPD | dbSNP | MGI SNP Detail
ChrX:60016922rF9 : Intron1SNP CCCCCCCC   CCTCCC CC CCCCC C  C/T
rs16814492
MPD | dbSNP | MGI SNP Detail
ChrX:60017016rF9 : Intron1SNP TTTTTTTT   TTTTTT TT TTCTT T  C/T
rs16814491
MPD | dbSNP | MGI SNP Detail
ChrX:60017018rF9 : Intron1SNP CCCCCCCC   CCTCCC CC CCCCC C  C/T
rs16814490
MPD | dbSNP | MGI SNP Detail
ChrX:60017026rF9 : Intron1SNP GGGGGGGG   GGAGGG GG GGGGG G  A/G
rs16814621
MPD | dbSNP | MGI SNP Detail
ChrX:60017130rF9 : Intron1SNP TTTTTTTT   TTCTTT TT  TTTT T  C/T
rs16814620
MPD | dbSNP | MGI SNP Detail
ChrX:60017178rF9 : Intron2SNPTTTTTTTCTT TTTCTTTTTTT TCTTTT TC/T
rs16814619
MPD | dbSNP | MGI SNP Detail
ChrX:60017264rF9 : Intron1SNP CCCCCCCC   CCTCCC CC  CCCC C  C/T
rs16814618
MPD | dbSNP | MGI SNP Detail
ChrX:60017269rF9 : Intron1SNP CCCCCCCC   CCTCCC CC  CCCC C  C/T
rs16814617
MPD | dbSNP | MGI SNP Detail
ChrX:60017282rF9 : Intron1SNP AAAAAAAA   AAAAAA AA  AGAA A  A/G
rs16814616
MPD | dbSNP | MGI SNP Detail
ChrX:60017291rF9 : Intron1SNP TTTTTTTT   TTCTTT TT  TTTT T  C/T
rs16814615
MPD | dbSNP | MGI SNP Detail
ChrX:60017326rF9 : Intron1SNP GGGGGGGG   GGAGGG GG  GGGG G  A/G
rs16814610
MPD | dbSNP | MGI SNP Detail
ChrX:60017412rF9 : Intron5Mixed --------   --T--- --  ---- -  -/A/T
rs16814609
MPD | dbSNP | MGI SNP Detail
ChrX:60017430rF9 : Intron1SNP GGGGGGGG   GGTGGG GG  GGGG G  G/T
rs16814608
MPD | dbSNP | MGI SNP Detail
ChrX:60017443rF9 : Intron1SNP GGGGGGGG   GGAGGG GG  GGGG G  A/G
rs16814607
MPD | dbSNP | MGI SNP Detail
ChrX:60017459rF9 : Intron2SNPCCCCCCCTCC CCCTCCCCCCC CCCCCC CC/T
rs16814606
MPD | dbSNP | MGI SNP Detail
ChrX:60017482rF9 : Intron1SNP TTTTTTGT   TTGTTT TT  TGTT T  G/T
rs16814599
MPD | dbSNP | MGI SNP Detail
ChrX:60017497rF9 : Intron7Mixed ??????-?   ??-??? ??  ?-?? ?  -/A/C/G/T
rs16814598
MPD | dbSNP | MGI SNP Detail
ChrX:60017504rF9 : Intron1SNP CCCCCCCC   CCCCCC CC  CACC C  A/C
rs16814597
MPD | dbSNP | MGI SNP Detail
ChrX:60017506rF9 : Intron1SNP CCCCCCCC   CCCCCC CC  CTCC C  C/T
SNP ID
(dbSNP Build 137)
Map Position
(GRCm38)
Gene : dbSNP Function ClassAssays
(ss)
Variation
Type
Allele
Summary
(all strains)
rs16814596
MPD | dbSNP | MGI SNP Detail
ChrX:60017597rF9 : Intron1SNP CCCCCCTC   CCCCCC CC  CCCC C  C/T
rs16814595
MPD | dbSNP | MGI SNP Detail
ChrX:60017611rF9 : Intron1Mixed AAAAAACA   AAAA-A  A   AAA A  -/A/C
rs16814580
MPD | dbSNP | MGI SNP Detail
ChrX:60017707rF9 : Intron1SNP TTTTTTTT   TTCTTT TT TTTTT T  C/T
rs16814579
MPD | dbSNP | MGI SNP Detail
ChrX:60017742rF9 : Intron1SNP AAAAAAAA   AAGAAA AA AAAAA A  A/G
rs16814578
MPD | dbSNP | MGI SNP Detail
ChrX:60017743rF9 : Intron1SNP CCCCCCCC   CCTCCC CC CCCCC C  C/T
rs16814577
MPD | dbSNP | MGI SNP Detail
ChrX:60017752rF9 : Intron1SNP TTTTTTTT   TTCTTT TT TTTTT T  C/T
rs16814576
MPD | dbSNP | MGI SNP Detail
ChrX:60017753rF9 : Intron2SNPTTTTTTTGTT TTTGTTT TTTTTGTTTT TG/T
rs16814575
MPD | dbSNP | MGI SNP Detail
ChrX:60017793rF9 : Intron1SNP CCCCCCCC   CCGCCC CC CCCCC C  C/G
rs16814574
MPD | dbSNP | MGI SNP Detail
ChrX:60017888rF9 : Intron1SNP TTTTTTTT   TTCTTT TT TTTTT T  C/T
rs16814573
MPD | dbSNP | MGI SNP Detail
ChrX:60017898rF9 : Intron2SNPAAAAAAAGAA AAAGAAAAAAAAAGAAAA AA/G
rs16814572
MPD | dbSNP | MGI SNP Detail
ChrX:60017939rF9 : Intron1SNP CCCCCCCC   CCCCCC CC CCTCC C  C/T
rs16814571
MPD | dbSNP | MGI SNP Detail
ChrX:60018045rF9 : Intron2SNPTTTTTTTCTT TTTCTTTTTTTTTCTTTT TC/T
rs16814570
MPD | dbSNP | MGI SNP Detail
ChrX:60018054rF9 : Intron1SNP CCCCCCCC   CCTCCC CC CCCCC C  C/T
rs31737048
MPD | dbSNP | MGI SNP Detail
ChrX:60018108fF9 : Intron1SNPTTTT T CTT T      T  T     T  TC/T
rs16814569
MPD | dbSNP | MGI SNP Detail
ChrX:60018191rF9 : Intron2SNPGGGGGGGAGG GGGGGGGG  GG G GGG GA/G
rs16814568
MPD | dbSNP | MGI SNP Detail
ChrX:60018197rF9 : Intron1SNP C  C CC    CCTCCC    C CCC C  C/T
rs31737047
MPD | dbSNP | MGI SNP Detail
ChrX:60018235fF9 : Intron1SNPGGGG G CGG G      G  G     G  GC/G
rs16818700
MPD | dbSNP | MGI SNP Detail
ChrX:60018387rF9 : Intron1SNP     C TT   TT        TT T  T  C/T
rs16818699
MPD | dbSNP | MGI SNP Detail
ChrX:60018390rF9 : Intron1SNP       AA   A         AAC      A/C
rs16818698
MPD | dbSNP | MGI SNP Detail
ChrX:60018482rF9 : Intron1SNP     GAG       G      G        A/G
rs16818697
MPD | dbSNP | MGI SNP Detail
ChrX:60018544rF9 : Intron1SNP      AG     A        G        A/G
rs16818696
MPD | dbSNP | MGI SNP Detail
ChrX:60018563rF9 : Intron1SNP      GT     G  G     T   G    G/T
rs16818695
MPD | dbSNP | MGI SNP Detail
ChrX:60018575rF9 : Intron1SNP      AG     A  A     G        A/G
rs16818694
MPD | dbSNP | MGI SNP Detail
ChrX:60018581rF9 : Intron1SNP      AG     A G      G     A  A/G
rs16818693
MPD | dbSNP | MGI SNP Detail
ChrX:60018585rF9 : Intron1SNP      GT     G  G     T        G/T
SNP ID
(dbSNP Build 137)
Map Position
(GRCm38)
Gene : dbSNP Function ClassAssays
(ss)
Variation
Type
Allele
Summary
(all strains)
rs16818692
MPD | dbSNP | MGI SNP Detail
ChrX:60018589rF9 : Intron1SNP      GT    TG  G     TT  G    G/T
rs16818691
MPD | dbSNP | MGI SNP Detail
ChrX:60018683rF9 : Intron1SNP      GT     G TG     T   G    G/T
rs16818690
MPD | dbSNP | MGI SNP Detail
ChrX:60018713rF9 : Intron1SNP      CAA   A   CA    AAC C    A/C
rs31115689
MPD | dbSNP | MGI SNP Detail
ChrX:60019510fF9 : Intron1SNP C    G                        C/G
rs33869406
MPD | dbSNP | MGI SNP Detail
ChrX:60019516fF9 : Intron1SNP C    G                        C/G
rs31074821
MPD | dbSNP | MGI SNP Detail
ChrX:60019522fF9 : Intron1SNP C    G                        C/G
rs16818705
MPD | dbSNP | MGI SNP Detail
ChrX:60019636rF9 : Intron1SNP C CCCCC    C  CCC CC TC    C  C/T
rs16818704
MPD | dbSNP | MGI SNP Detail
ChrX:60019688rF9 : Intron1SNP A AAAAA       AAA AA T        A/T
rs16818703
MPD | dbSNP | MGI SNP Detail
ChrX:60019735rF9 : Intron1SNP     CCC    C   C     T        C/T
rs16818702
MPD | dbSNP | MGI SNP Detail
ChrX:60019790rF9 : Intron2SNPGGGGGGGAGG GGG GGGGGGG G GGGG GA/G
rs16818701
MPD | dbSNP | MGI SNP Detail
ChrX:60019821rF9 : Intron1SNP C CCCCC     C CCC C  G     C  C/G
rs16814449
MPD | dbSNP | MGI SNP Detail
ChrX:60019997rF9 : Intron2SNPGGGGGGGAGG GGGA GGGGGGGGAGGGG GA/G
rs16814448
MPD | dbSNP | MGI SNP Detail
ChrX:60020028rF9 : Intron1SNP CCCCCCCC   CCA CC CC CCCCC C  A/C
rs16814447
MPD | dbSNP | MGI SNP Detail
ChrX:60020119rF9 : Intron1SNP GGGGGGGG   GGCGGG GG GGGGG G  C/G
rs16814446
MPD | dbSNP | MGI SNP Detail
ChrX:60020424rF9 : Intron1SNP AAAAAAAA   AAGAAA AA AAAAA A  A/G
rs16814445
MPD | dbSNP | MGI SNP Detail
ChrX:60020470rF9 : Intron1IN-DEL AAAAAAAA   AA-AAA AA AAAA     -/A
rs16814444
MPD | dbSNP | MGI SNP Detail
ChrX:60020471rF9 : Intron1IN-DEL GGGGGGG     G-GGG    G G      -/G
rs16814443
MPD | dbSNP | MGI SNP Detail
ChrX:60020472rF9 : Intron1IN-DEL AAAAAAA     A-AAA A  A A      -/A
rs16814581
MPD | dbSNP | MGI SNP Detail
ChrX:60020473rF9 : Intron1IN-DEL GGGGGGG     G-GGG G  G G      -/G
rs16818709
MPD | dbSNP | MGI SNP Detail
ChrX:60020567rF9 : Intron1SNP TTTTTTTT   TT TTT TT TTATT T  A/T
rs16818708
MPD | dbSNP | MGI SNP Detail
ChrX:60020815rF9 : Intron1SNP AAAAAAAA   AA AAA AA AAAAA G  A/G
rs16818707
MPD | dbSNP | MGI SNP Detail
ChrX:60020991rF9 : Intron1SNP GGGGGGGG   GG GGG GG GGAGG G  A/G
rs16818706
MPD | dbSNP | MGI SNP Detail
ChrX:60021041rF9 : Intron1SNP CCCCCCCC   CC CCC CC CCTCC C  C/T
rs16818711
MPD | dbSNP | MGI SNP Detail
ChrX:60021352rF9 : Intron1SNP TTTTTT T   TT TTT TT TTCTT T  C/T
rs16818710
MPD | dbSNP | MGI SNP Detail
ChrX:60021353rF9 : Intron1SNP AAAAAA A   AA AAA AA AAGAA A  A/G
SNP ID
(dbSNP Build 137)
Map Position
(GRCm38)
Gene : dbSNP Function ClassAssays
(ss)
Variation
Type
Allele
Summary
(all strains)
rs16814626
MPD | dbSNP | MGI SNP Detail
ChrX:60022347rF9 : Intron1SNP AAAAAA     AAGAAA AA AAGAA A  A/G
rs16814625
MPD | dbSNP | MGI SNP Detail
ChrX:60022391rF9 : Intron1SNP CCCCCCCC   CCTCCC CC CCCCC C  C/T
rs16814624
MPD | dbSNP | MGI SNP Detail
ChrX:60022557rF9 : Intron1SNP CCCCCCTC   CCTCCC CC CCTCC C  C/T
rs16814623
MPD | dbSNP | MGI SNP Detail
ChrX:60022714rF9 : Intron1SNP AAAAAAAA   AAGAAA AA AAAAA A  A/G
rs16814622
MPD | dbSNP | MGI SNP Detail
ChrX:60022719rF9 : Intron1IN-DEL TTTTTT--   TTTTTT TT TTT-T T  -/T
rs16818712
MPD | dbSNP | MGI SNP Detail
ChrX:60023672fF9 : Intron1SNP     T C              C        C/T
rs16818713
MPD | dbSNP | MGI SNP Detail
ChrX:60023677fF9 : Intron1SNP     T C              C        C/T
rs16818714
MPD | dbSNP | MGI SNP Detail
ChrX:60023725fF9 : Intron1SNP G   G T       G      T     G  G/T
rs16818715
MPD | dbSNP | MGI SNP Detail
ChrX:60023728fF9 : Intron1SNP G   G T              T        G/T
rs16818716
MPD | dbSNP | MGI SNP Detail
ChrX:60023730fF9 : Intron1SNP GT    TT    T   T T  T     G  G/T
rs16818717
MPD | dbSNP | MGI SNP Detail
ChrX:60023737fF9 : Intron1SNP T   T                C        C/T
rs16818718
MPD | dbSNP | MGI SNP Detail
ChrX:60023774fF9 : Intron1SNP T   T C              C     T  C/T
rs16818719
MPD | dbSNP | MGI SNP Detail
ChrX:60023776fF9 : Intron1SNP T     C     C C      C     T  C/T
rs16818720
MPD | dbSNP | MGI SNP Detail
ChrX:60023824fF9 : Intron1SNP G           C C      CC    G  C/G
rs16818721
MPD | dbSNP | MGI SNP Detail
ChrX:60023836fF9 : Intron1SNP GAAA AAA   AA  AA A  AA AA    A/G
rs16818722
MPD | dbSNP | MGI SNP Detail
ChrX:60023839fF9 : Intron1SNP CA   AA        AA    A     C  A/C
rs16818723
MPD | dbSNP | MGI SNP Detail
ChrX:60023843fF9 : Intron1SNP   C TCC       C      CC    T  C/T
rs29057454
MPD | dbSNP | MGI SNP Detail
ChrX:60023938fF9 : Intron1SNPTTTT T TTT T      T  T     T  AA/T
rs16818725
MPD | dbSNP | MGI SNP Detail
ChrX:60024128rF9 : Intron1SNP CCCCCCCC   CC CCC CC CCTCC C  C/T
rs16818724
MPD | dbSNP | MGI SNP Detail
ChrX:60024551rF9 : Intron1SNP AAAA  GA   AA AAA AA AA AA A  A/G
rs31737046
MPD | dbSNP | MGI SNP Detail
ChrX:60024797fF9 : Intron1SNPAAAA A GAA A      A  A     A  AA/G
rs31737045
MPD | dbSNP | MGI SNP Detail
ChrX:60024978fF9 : Intron1SNPGGGG G AGG G      G  G     G  GA/G
rs29057353
MPD | dbSNP | MGI SNP Detail
ChrX:60025282fF9 : Intron1SNPTTTT T TTTTT      T  T     T CTC/T
rs29057352
MPD | dbSNP | MGI SNP Detail
ChrX:60025347fF9 : Intron1SNPGGGG G GGGAG      G  G     G AGA/G
rs16814632
MPD | dbSNP | MGI SNP Detail
ChrX:60025726rF9 : Intron1SNP CCCCCCCC   CCGCCC CC CCCCC    C/G
SNP ID
(dbSNP Build 137)
Map Position
(GRCm38)
Gene : dbSNP Function ClassAssays
(ss)
Variation
Type
Allele
Summary
(all strains)
rs16814631
MPD | dbSNP | MGI SNP Detail
ChrX:60025760rF9 : Intron1SNP TTTTTTTT   TTCTTT TT TTTTT T  C/T
rs16814630
MPD | dbSNP | MGI SNP Detail
ChrX:60025832rF9 : Intron1SNP GGGGGGGG   GGTGGG GG GGGGG G  G/T
rs16814629
MPD | dbSNP | MGI SNP Detail
ChrX:60025988rF9 : Intron1SNP GGGGGGGG   GGAGGG GG GGGGG G  A/G
rs16814628
MPD | dbSNP | MGI SNP Detail
ChrX:60026079rF9 : Intron1SNP GGGGGGGG   GGAGGG GG GGGGG G  A/G
rs16814627
MPD | dbSNP | MGI SNP Detail
ChrX:60026139rF9 : Intron1SNP TTTTTTTT   TTCTTT TT TTTTT T  C/T
rs16814644
MPD | dbSNP | MGI SNP Detail
ChrX:60026304rF9 : Intron1SNP TTTTTTTT   TTCTTT TT TTTTT T  C/T
rs16814637
MPD | dbSNP | MGI SNP Detail
ChrX:60026484rF9 : Intron7Mixed AAAAAAAA   AA-AAA AA AAAAA A  -/A/C/T
rs16814636
MPD | dbSNP | MGI SNP Detail
ChrX:60026505rF9 : Intron1SNP TTTTTTTT   TTCTTT TT TTTTT T  C/T
rs16814635
MPD | dbSNP | MGI SNP Detail
ChrX:60026702rF9 : Intron1SNP TTTTTTTT   TTCTTT TT TTTTT T  C/T
rs16814634
MPD | dbSNP | MGI SNP Detail
ChrX:60026721rF9 : Intron2SNPGGGGGGGTGGTGGGTGGGGGGGGGTGGGGTGG/T
rs16814633
MPD | dbSNP | MGI SNP Detail
ChrX:60026781rF9 : Intron1SNP CCCCCCCC   CCTCCC CC CCCCC C  C/T
rs29057351
MPD | dbSNP | MGI SNP Detail
ChrX:60026859fF9 : Intron1SNPGGGG G GGGAG      G  G     G AGA/G
rs16814651
MPD | dbSNP | MGI SNP Detail
ChrX:60026951rF9 : Intron1IN-DEL CCCCCCC    CC-CCC CC CCCCC C  -/C
rs16814650
MPD | dbSNP | MGI SNP Detail
ChrX:60026966rF9 : Intron1SNP GGGGGGGG   GGAGGG GG GGGGG G  A/G
rs16814649
MPD | dbSNP | MGI SNP Detail
ChrX:60027040rF9 : Intron1SNP AAAAAAAA   AAGAAA AA AAAAA A  A/G
rs16814648
MPD | dbSNP | MGI SNP Detail
ChrX:60027163rF9 : Intron1SNP AAAAAAAA   AAGAAA AA AAAAA A  A/G
rs16814647
MPD | dbSNP | MGI SNP Detail
ChrX:60027259rF9 : Intron1SNP CCCCCCCC   CCGCCC CC CCCCC C  C/G
rs16814646
MPD | dbSNP | MGI SNP Detail
ChrX:60027262rF9 : Intron1SNP TTTTTTTT   TTCTTT TT TTTTT T  C/T
rs16814645
MPD | dbSNP | MGI SNP Detail
ChrX:60027283rF9 : Intron1SNP TTTTTTTT   TTGTTT TT TTTTT T  G/T
rs16814456
MPD | dbSNP | MGI SNP Detail
ChrX:60027503rF9 : Intron1SNP AAAAAAAA   AAGAAA AA AAAAA A  A/G
rs16814455
MPD | dbSNP | MGI SNP Detail
ChrX:60027525rF9 : Intron1SNP AAAAAAAA   AAGAAA AA AAAAA A  A/G
rs16814454
MPD | dbSNP | MGI SNP Detail
ChrX:60027535rF9 : Intron1SNP CCCCCCCC   CCTCCC CC CCCCC C  C/T
rs16814453
MPD | dbSNP | MGI SNP Detail
ChrX:60027786rF9 : Intron1SNP TTTTTTTT   TTCTTT TT TTTTT T  C/T
rs16814452
MPD | dbSNP | MGI SNP Detail
ChrX:60027787rF9 : Intron1SNP TTTTTTTT   TTATTT TT TTTTT T  A/T
rs16814451
MPD | dbSNP | MGI SNP Detail
ChrX:60027815rF9 : Intron1SNP CCCCCCCC   CCTCCC CC CCCCC C  C/T
SNP ID
(dbSNP Build 137)
Map Position
(GRCm38)
Gene : dbSNP Function ClassAssays
(ss)
Variation
Type
Allele
Summary
(all strains)
rs31737044
MPD | dbSNP | MGI SNP Detail
ChrX:60027836fF9 : Intron1SNPGGGG G CGGGG         G     G GGC/G
rs16814450
MPD | dbSNP | MGI SNP Detail
ChrX:60027855rF9 : Intron1SNP AAAAAAAA   AACAAA AA AAAAA A  A/C
rs16814468
MPD | dbSNP | MGI SNP Detail
ChrX:60028057rF9 : Intron1SNP TTTTT TT   TTCTTT TT TTTTT T  C/T
rs16814467
MPD | dbSNP | MGI SNP Detail
ChrX:60028106rF9 : Intron1SNP TTTTTTTT   TTCTTT TT TTTTT T  C/T
rs16814466
MPD | dbSNP | MGI SNP Detail
ChrX:60028189rF9 : Intron1SNP AAAAAAGA   AAGAAA AA AAAAA A  A/G
rs16814465
MPD | dbSNP | MGI SNP Detail
ChrX:60028200rF9 : Intron1SNP GGGGGGGG   GGGGGG GG GGAGG G  A/G
rs16814464
MPD | dbSNP | MGI SNP Detail
ChrX:60028220rF9 : Intron1SNP AAAAAAAA   AAGAAA AA AAAAA A  A/G
rs16814463
MPD | dbSNP | MGI SNP Detail
ChrX:60028247rF9 : Intron1IN-DEL CCCCCCCC   CC-CCC CC CCCCC C  -/C
rs16814462
MPD | dbSNP | MGI SNP Detail
ChrX:60028286rF9 : Intron2SNPTTTTTTTCTTTTTTCTTT TTTTTTTTTTTTC/T
rs16814461
MPD | dbSNP | MGI SNP Detail
ChrX:60028302rF9 : Intron1SNP GGGGGGGG   GGCGGG GG GGGGG G  C/G
rs16814460
MPD | dbSNP | MGI SNP Detail
ChrX:60028331rF9 : Intron1SNP GGGGGGGG   GGAGGG GG GGGGG G  A/G
rs16814459
MPD | dbSNP | MGI SNP Detail
ChrX:60028379rF9 : Intron1SNP TTTTTTTT   TTCTTT TT TTTTT T  C/T
rs16814458
MPD | dbSNP | MGI SNP Detail
ChrX:60028401rF9 : Intron1SNP TTTTTTTT   TTCTTT TT TTTTT T  C/T
rs16814457
MPD | dbSNP | MGI SNP Detail
ChrX:60028515rF9 : Coding-Synonymous1SNP AA AAAAA   AAGAAA AA AAAAA A  A/G
rs16814471
MPD | dbSNP | MGI SNP Detail
ChrX:60028773rF9 : Intron1SNP GGGGGGGG   GGTGGG GG GGGGG G  G/T
rs16814470
MPD | dbSNP | MGI SNP Detail
ChrX:60028798rF9 : Intron1SNP AAAAAAAA   AAGAAA AA AAAAA A  A/G
rs16814469
MPD | dbSNP | MGI SNP Detail
ChrX:60029114rF9 : Coding-Synonymous1SNP GGGGGGGG   GGCGGG GG GGGGG G  C/G
rs16814516
MPD | dbSNP | MGI SNP Detail
ChrX:60029189rF9 : Coding-Synonymous1SNP AAAAAAAA   AAGAAA AA AAAAA A  A/G
rs16814515
MPD | dbSNP | MGI SNP Detail
ChrX:60029190rF9 : Coding-Synonymous1SNP TTTTTTTT   TTGTTT TT TTTTT T  G/T
rs16814514
MPD | dbSNP | MGI SNP Detail
ChrX:60029473rF9 : mRNA-UTR1SNP CCCCCCCC   CCTCCC CC CC CC C  C/T
rs29057350
MPD | dbSNP | MGI SNP Detail
ChrX:60029485fF9 : mRNA-UTR1SNPGGGG G  GGAG      G  G     G AGA/G
rs16814513
MPD | dbSNP | MGI SNP Detail
ChrX:60029672rF9 : mRNA-UTR1SNP AAAAAAAA   AAGAAA AA AAAAA A  A/G
rs16814473
MPD | dbSNP | MGI SNP Detail
ChrX:60029781rF9 : mRNA-UTR1SNP AAAAAAAA   AACAAA AA AAAAA A  A/C
rs16814472
MPD | dbSNP | MGI SNP Detail
ChrX:60029791rF9 : mRNA-UTR1SNP AAAAAAAA   AAGAAA AA AAAAA A  A/G
rs29057349
MPD | dbSNP | MGI SNP Detail
ChrX:60030534fF9 : mRNA-UTR1SNPGGGG G AGGGG      G  G     G GGA/G
SNP ID
(dbSNP Build 137)
Map Position
(GRCm38)
Gene : dbSNP Function ClassAssays
(ss)
Variation
Type
Allele
Summary
(all strains)
rs29057348
MPD | dbSNP | MGI SNP Detail
ChrX:60030893fF9 : Locus-Region1SNPAAAA A AAAAA      A  A     A GAA/G
rs29057347
MPD | dbSNP | MGI SNP Detail
ChrX:60030925fF9 : Locus-Region1SNPGGGG G TGGTG         G     G TGG/T
rs31736043
MPD | dbSNP | MGI SNP Detail
ChrX:60031417fF9 : 658 bp downstream of1SNP       C  AA               A   A/C
rs31736042
MPD | dbSNP | MGI SNP Detail
ChrX:60031483fF9 : 724 bp downstream of1SNPGGGG G AGGGG      G  G     G GGA/G
rs29057346
MPD | dbSNP | MGI SNP Detail
ChrX:60031682fF9 : 923 bp downstream of1SNPTTTT T CTTCT      T  T     T CTC/T
rs31736041
MPD | dbSNP | MGI SNP Detail
ChrX:60031712fF9 : 953 bp downstream of1SNP AA  A GA AA               A AAA/G
rs29057345
MPD | dbSNP | MGI SNP Detail
ChrX:60031821fF9 : 1062 bp downstream of1SNPAAAA A GAAAA      A  A     A AAA/G
rs29057344
MPD | dbSNP | MGI SNP Detail
ChrX:60032047fF9 : 1288 bp downstream of1SNPGGGG G GGGAG      G  G     G AGA/G
rs29057193
MPD | dbSNP | MGI SNP Detail
ChrX:60032074fF9 : 1315 bp downstream of1SNPGGGG G GGGAG         G     G AGA/G
rs29057192
MPD | dbSNP | MGI SNP Detail
ChrX:60032279fF9 : 1520 bp downstream of1SNP CC  C  C TC         C     C  CC/T
rs31736040
MPD | dbSNP | MGI SNP Detail
ChrX:60032487fF9 : 1728 bp downstream of1SNPCCCC C TCCCC      C  C     C CCC/T

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Tumor Biology (MTB), Gene Ontology (GO), MouseCyc
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
04/08/2014
MGI 5.17
The Jackson Laboratory