About   Help   FAQ
Endonuclease-mediated Allele Detail
Symbol: Alg3em1(IMPC)J
Name: asparagine-linked glycosylation 3 (alpha-1,3-mannosyltransferase); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6194900
Gene: Alg3  Location: Chr16:20424208-20429515 bp, - strand  Genetic Position: Chr16, 12.48 cM
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AACTGGCCCTGGCCTGAAGT, GTTCACCCAGAGAATGCCGT, CAGGTTTGGGGAGCTGACGT and AGAGATTCTACCTCATTCCC, which resulted in a 536 bp deletion beginning at Chromosome 16 position 20,608,702 bp and ending after 20,609,237 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000314958, ENSMUSE00001226643, and ENSMUSE00001255837 (exons 2,3,4) and 127 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 65 and early truncation 5 amino acids later. (J:188991)
Inheritance:    Not Specified
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Alg3 Mutation:  10 strains or lines available
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
MGI 6.21
The Jackson Laboratory