About   Help   FAQ
Rr308em3Krg
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr308em3Krg
Name: regulatory region 308; endonuclease-mediated mutation 3, Michael S Krangel
MGI ID: MGI:7779684
Synonyms: EalphadeltaE1deltaE3(1)
Gene: Rr308  Location: unknown  Genetic Position: Chr14, Syntenic
Alliance: Rr308em3Krg page
Mutation
origin
Strain of Origin:  B6SJLF1/J
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsE-box E3 in the Tcra enhancer was targeted in cells containing the Rr308em1Krg allele using an sgRNA (GGCCTTCTTTTCTGCACCTG) with CRISPR/Cas9 technology, resulting in a deletion, resulting in the deletion of one of a G nucleotide pair (GRCm39:chr14:54465106) (in addition to the existing deletion of TTCCCTCCAGGTG). (J:338557)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr308 Mutation:  0 strains or lines available
References
Original:  J:338557 Mihai A, et al., E protein binding at the Tcra enhancer promotes Tcra repertoire diversity. Front Immunol. 2023;14:1188738
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory