Rr308^em1Krg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr308^em1Krg
• Name: regulatory region 308; endonuclease-mediated mutation 1, Michael S Krangel
• MGI ID: MGI:7779649
• Synonyms: Ealpha^deltaE1
• Gene: Rr308 Location: unknown Genetic Position: Chr14, Syntenic
• Alliance: Rr308^em1Krg page

Mutation origin

• Strain of Origin: B6SJLF1/J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: E-box E1 in the Tcra enhancer was targeted using sgRNAs (equivalent to TCCATTTCCTGTTCTACTTC and CCCACTTCCCTCCAGGTGTTT) and an ssODN template with CRISPR/Cas9 technology, resulting in the deletion of TTCCCTCCAGGTG (GRCm39:chr14:54464896-54464908). (J:338557)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr308 Mutation: 0 strains or lines available

References

• Original: J:338557 Mihai A, et al., E protein binding at the Tcra enhancer promotes Tcra repertoire diversity. Front Immunol. 2023;14:1188738
• All: 1 reference(s)