Rr308em2Krg
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rr308em2Krg |
| Name: |
regulatory region 308; endonuclease-mediated mutation 2, Michael S Krangel |
| MGI ID: |
MGI:7779650 |
| Synonyms: |
EalphadeltaE1deltaE3 |
| Gene: |
Rr308 Location: unknown Genetic Position: Chr14, Syntenic
|
| Alliance: |
Rr308em2Krg page
|
|
| Strain of Origin: |
B6SJLF1/J
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Intergenic deletion
|
| |
|
Mutation details: E-box E3 in the Tcra enhancer was targeted in cells containing the Rr308em1Krg allele using an sgRNA (GGCCTTCTTTTCTGCACCTG) with CRISPR/Cas9 technology, resulting in a deletion, resulting in the deletion of CAGGTG (GRCm39:chr14:54465103-54465108) (in addition to the existing deletion of TTCCCTCCAGGTG).
(J:338557)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr308 Mutation: |
0 strains or lines available
|
|
| Original: |
J:338557 Mihai A, et al., E protein binding at the Tcra enhancer promotes Tcra repertoire diversity. Front Immunol. 2023;14:1188738 |
| All: |
1 reference(s) |
|