Rr493^em3Andg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr493^em3Andg
• Name: regulatory region 493; endonuclease-mediated mutation 3, Guillaume Andrey
• MGI ID: MGI:7703518
• Synonyms: Pitx1^deltaPen
• Gene: Rr493 Location: Chr13:56306831-56309000 bp Genetic Position: Chr13, Syntenic
• Alliance: Rr493^em3Andg page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:317420
• Parent Cell Line: G4 (ES Cell)
• Strain of Origin: (129S6/SvEvTac x C57BL/6NCrl)F1

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Deletion
• Mutation details: A 1.2-kb region, containing Pitx1 pan-limb enhancer Pen, was deleted using sgRNAs (equivalent to GCCTAGTGGAGGCGCGGCTT and CGTGCTATCGAGGGACTAAT) with CRISPR/Cas9 technology using ES cells that contain the Rr496^em2Andg allele. (J:317420)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr493 Mutation: 0 strains or lines available

References

• Original: J:317420 Rouco R, et al., Cell-specific alterations in Pitx1 regulatory landscape activation caused by the loss of a single enhancer. Nat Commun. 2021 Dec 13;12(1):7235
• All: 1 reference(s)