Rr496^em2Andg
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr496^em2Andg
• Name: regulatory region 496; endonuclease-mediated mutation 2, Guillaume Andrey
• MGI ID: MGI:7703479
• Synonyms: Pitx1^GFP
• Gene: Rr496 Location: unknown Genetic Position: Chr13, Syntenic
• Alliance: Rr496^em2Andg page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:317420
• Parent Cell Line: G4 (ES Cell)
• Strain of Origin: (129S6/SvEvTac x C57BL/6NCrl)F1

Mutation description

• Allele Type: Endonuclease-mediated (Reporter)
• Mutation: Insertion
• Mutation details: A DNA construct containing 50-bp of the beta-globin gene promoter upstream of the EGFP green fluorescent reporter gene was inserted upstream of the Pitx1 promoter using an sgRNA (targeting GAAACCGGGAGACGGTGATC GRCm39:chr13:55981823-55981842) with CRISPR/Cas9 technology. The reporter recapitulates Pitx1 expression. (J:317420)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr496 Mutation: 0 strains or lines available

References

• Original: J:317420 Rouco R, et al., Cell-specific alterations in Pitx1 regulatory landscape activation caused by the loss of a single enhancer. Nat Commun. 2021 Dec 13;12(1):7235
• All: 1 reference(s)