Rr364670^em3Dahe
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr364670^em3Dahe
• Name: regulatory region 364670; endonuclease-mediated mutation 3, Daniel Herranz
• MGI ID: MGI:7287727
• Synonyms: PE^-
• Gene: Rr364670 Location: Chr19:33198402-33204863 bp, . strand Genetic Position: Chr19, Syntenic
• Alliance: Rr364670^em3Dahe page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: Using sgRNAs (targeting GCCGTTCTTCCTAATGTGCA and GGAAGTGTCAACATCACCAG) with CRISPR/Cas9 technology, a genomic region (chr19:33198267-33202359 GRCm39) containing the Pten enhancer, located in intron 4 of Rnls, was deleted. (J:320472)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr364670 Mutation: 1 strain or line available

References

• Original: J:320472 Tottone L, et al., A Tumor Suppressor Enhancer of PTEN in T-cell development and leukemia. Blood Cancer Discov. 2021 Jan;2(1):92-109
• All: 1 reference(s)