About   Help   FAQ
Rr364670em3Dahe
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr364670em3Dahe
Name: regulatory region 364670; endonuclease-mediated mutation 3, Daniel Herranz
MGI ID: MGI:7287727
Synonyms: PE-
Gene: Rr364670  Location: Chr19:33198402-33204863 bp  Genetic Position: Chr19, Syntenic
Alliance: Rr364670em3Dahe page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsUsing sgRNAs (targeting GCCGTTCTTCCTAATGTGCA and GGAAGTGTCAACATCACCAG) with CRISPR/Cas9 technology, a genomic region (chr19:33198267-33202359 GRCm39) containing the Pten enhancer, located in intron 4 of Rnls, was deleted. (J:320472)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr364670 Mutation:  1 strain or line available
References
Original:  J:320472 Tottone L, et al., A Tumor Suppressor Enhancer of PTEN in T-cell development and leukemia. Blood Cancer Discov. 2021 Jan;2(1):92-109
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory