Nr3c1^em2Clib
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nr3c1^em2Clib
• Name: nuclear receptor subfamily 3, group C, member 1; endonuclease-mediated mutation 2, Claude Libert
• MGI ID: MGI:6511988
• Synonyms: GR^A465T,I634A, GR^dim1,dim2, GR^D+L
• Gene: Nr3c1 Location: Chr18:39543598-39652474 bp, - strand Genetic Position: Chr18, 21.09 cM
• Alliance: Nr3c1^em2Clib page

Mutation origin

• Strain of Origin: FVB/NJ

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Using an sgRNA (targeting GCTATGCTTTGCTCCTGA) and ssODN template (G GCATTTGCCCTGGGTTGGAGATCATACAGACAAGCAAGTGGAAACCTGCTATGCTTTGCTCCTGATCTGATTATTAATGAGTAAGTTACATGGCCTTAACCCTCCACAAAGAACTA) with CRISPR/Cas9 technology, isoleucine codon 643 (ATT) in exon 6 was changed to alanine (GCT) (p.I643A). Targeting was performed in Nr3c1^tm3Gsc heterozygote zygotes to produce mice with either p.I643A only (Nr3c1^em1Clib) or p.I643A plus p.A474T in cis (this allele). Peptide coordinates are in reference to canonical sequence SW:P06537-1 with the full complement of polyQ at the N-terminal end. (J:303222, J:322619)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nr3c1 Mutation: 35 strains or lines available

Notes

This allele was generated from Nr3c1^tm3Gsc.

References

• Original: J:303222 Libert C, Direct Data Submission for two Nr3c1 alleles. MGI Direct Data Submission. 2021
• All: 2 reference(s)