About   Help   FAQ
Ythdf1em3Jhha
Endonuclease-mediated Allele Detail
Summary
Symbol: Ythdf1em3Jhha
Name: YTH N6-methyladenosine RNA binding protein 1; endonuclease-mediated mutation 3, Jacob Hanna
MGI ID: MGI:6491621
Gene: Ythdf1  Location: Chr2:180546170-180562729 bp, - strand  Genetic Position: Chr2, 103.5 cM
Alliance: Ythdf1em3Jhha page
Mutation
origin
Strain of Origin:  (C57BL/6 x 129S4/SvJae)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThe 5' end of exon 4 was targeted with sgRNAs (targeting ATTTCCTTACTCCCTCAGCG and GGATAGTAACTGGACAGGTA) using CRISPR/Cas9 technology, resulting in a 59 bp deletion. This allele occurs in conjunction with the Ythdf1em1Jhha, Ythdf2em1Jhha and Ythdf3em1Jhha alleles in the same ESC line. (J:299108)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Ythdf1 Mutation:  35 strains or lines available
References
Original:  J:299108 Lasman L, et al., Context-dependent functional compensation between Ythdf m(6)A reader proteins. Genes Dev. 2020 Oct 1;34(19-20):1373-1391
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory