Ythdf3^em1Jhha
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ythdf3^em1Jhha
• Name: YTH N6-methyladenosine RNA binding protein 3; endonuclease-mediated mutation 1, Jacob Hanna
• MGI ID: MGI:6491615
• Gene: Ythdf3 Location: Chr3:16237376-16271201 bp, + strand Genetic Position: Chr3, 4.04 cM
• Alliance: Ythdf3^em1Jhha page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:299108
• Parent Cell Line: v6.5 (ES Cell)
• Strain of Origin: (C57BL/6 x 129S4/SvJae)F1

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: The 5' end of exon 4 was targeted with sgRNAs (targeting ATTGGATTTCCATATTCTCT and ATATATGGATCTGACATTGG) using CRISPR/Cas9 technology, resulting in a 40 bp deletion. This allele occurs in conjunction with the Ythdf1^em1Jhha, Ythdf1^em3Jhha and Ythdf2^em1Jhha alleles in the same ESC line. (J:299108)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ythdf3 Mutation: 52 strains or lines available

References

• Original: J:299108 Lasman L, et al., Context-dependent functional compensation between Ythdf m(6)A reader proteins. Genes Dev. 2020 Oct 1;34(19-20):1373-1391
• All: 1 reference(s)