About   Help   FAQ
Ythdf3em1Jhha
Endonuclease-mediated Allele Detail
Summary
Symbol: Ythdf3em1Jhha
Name: YTH N6-methyladenosine RNA binding protein 3; endonuclease-mediated mutation 1, Jacob Hanna
MGI ID: MGI:6491615
Gene: Ythdf3  Location: Chr3:16237376-16271201 bp, + strand  Genetic Position: Chr3, 4.04 cM
Alliance: Ythdf3em1Jhha page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:299108
Parent Cell Line:  v6.5 (ES Cell)
Strain of Origin:  (C57BL/6 x 129S4/SvJae)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThe 5' end of exon 4 was targeted with sgRNAs (targeting ATTGGATTTCCATATTCTCT and ATATATGGATCTGACATTGG) using CRISPR/Cas9 technology, resulting in a 40 bp deletion. This allele occurs in conjunction with the Ythdf1em1Jhha, Ythdf1em3Jhha and Ythdf2em1Jhha alleles in the same ESC line. (J:299108)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Ythdf3 Mutation:  54 strains or lines available
References
Original:  J:299108 Lasman L, et al., Context-dependent functional compensation between Ythdf m(6)A reader proteins. Genes Dev. 2020 Oct 1;34(19-20):1373-1391
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory