About   Help   FAQ
Notumem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Notumem1(IMPC)Tcp
Name: notum palmitoleoyl-protein carboxylesterase; endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6156499
Gene: Notum  Location: Chr11:120544614-120552001 bp, - strand  Genetic Position: Chr11, 84.38 cM
Alliance: Notumem1(IMPC)Tcp page
IMPC: Notum gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR0445 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of CGCAAAAGGAACGCACAAGC and AGGGCTTGAGGATTCCGGTT targeting the 5' side and CCTGCCCTGTCTTAATGGGC and GTGCAAGAGGCCCTGCTAGG targeting the 3' side of a critical region. This resulted in a 221 bp deletion of Chr11 from 120657737 to 120658957.(GRCm38). (J:237616, J:384794)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 32 assay results
1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 4 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Notum Mutation:  31 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  6 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/16/2026
MGI 6.24
The Jackson Laboratory