Tyr-pA1, Tyr-pB1 Primer Detail MGI Mouse MGI:8609

About Help FAQ

Tyr-pA1, Tyr-pB1 Primer Detail

Name

Tyr-pA1, Tyr-pB1
Primer 1 Sequence

TCCGAATTCAAAGGGGTGGATGACCG
Primer 2 Sequence

GACACATAGTAATGCATCC
ID

MGI:8609
Product Size

~341bp

Tyr

tyrosinase

J:40223 Jackson IJ, et al., Proc Natl Acad Sci U S A. 1990 Sep;87(18):7010-4

Endonuclease	Gene	Allele	Fragments	Strains
DdeI	Tyr	a	130, 113, 63, 85bp	A/J, AKR/J, BALB/cJ, BUB/BnJ, DA/HuSnJ, DDK, HRS/J, LG/J, MA/MyJ, NZW/LacJ, PL/J, RF/J, RIIIS/J, SJL/J, SWR/J
DdeI	Tyr	b	165, 113, 63bp	C57BL/6J

J:40223 Jackson IJ, et al., Identification of the albino mutation of mouse tyrosinase by analysis of an in vitro revertant. Proc Natl Acad Sci U S A. 1990 Sep;87(18):7010-4

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23