Lck-pA, Lck-pB Primer Detail MGI Mouse MGI:827

Lck-pA, Lck-pB Primer Detail

Name

Lck-pA, Lck-pB
Primer 1 Sequence

GCAGATGGAATTCCTGTGCCA
Primer 2 Sequence

ACACACAGAGACATGAGATTGGAT
ID

MGI:827
Product Size

339bp

Lck

lymphocyte protein tyrosine kinase

J:3351 Todd JA, et al., Nature. 1991 Jun 13;351(6327):542-7

Endonuclease	Gene	Allele	Fragments	Strains
HaeIII	Lck	b	260bp	B10.H2^g7
HaeIII	Lck	n	200bp	NOD

J:20039 Fiedorek FT Jr, et al., Mamm Genome. 1994 Aug;5(8):479-85

Notes: Electrophoretic variants distinguishing the two strains were identified using single stranded conformation polymorphic analysis.

Endonuclease	Gene	Allele	Fragments	Strains
	Lck	b	not given	BKS.D-Dock7^m
	Lck	c	not given	CZECHII

J:3351 Todd JA, et al., Genetic analysis of autoimmune type 1 diabetes mellitus in mice [see comments]. Nature. 1991 Jun 13;351(6327):542-7

J:20039 Fiedorek FT Jr, et al., Mapping of PCR-based markers for mouse chromosome 4 on a backcross penetrant for the misty (m) mutation. Mamm Genome. 1994 Aug;5(8):479-85

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/16/2024 MGI 6.23