About   Help   FAQ
D17Rua2-pA, D17Rua2-pB Primer Detail
Primers
  • Name
    D17Rua2-pA, D17Rua2-pB
  • Primer 1 Sequence
    CTTGCCCTTCTAAGACCTAA
  • Primer 2 Sequence
    ACTGTATAGACTCAAGTCAG
  • ID
    MGI:789
  • Region Covered
    intron 2 of H2-Ea
  • Product Size
    170bp
Genes
H2-Ea histocompatibility 2, class II antigen E alpha
D17Rua2 DNA segment, Chr 17, Rutgers University 2
Polymorphisms
J:20144 Heine D, et al., Genomics. 1994 Sep 1;23(1):168-77
Endonuclease Gene Allele Fragments Strains
D17Rua2 a largest A.SW-H2s/Sn
b larger B10.K-H2k
c smaller B10.D2-Hc0 H2d H2-T18c/oSnJ
p smallest C3.NB-H2p, P/J
J:32563 Khambata S, et al., Genome Res. 1996 Mar;6(3):195-201
Endonuclease Gene Allele Fragments Strains
D17Rua2 a not given B10.F-H2pb1/(13R)J
c not given B10.S-H2t4/(9R)/J, C57BL/10
d not given A.TL-H2t1
References
J:20144 Heine D, et al., Analysis of recombinational hot spots associated with the p haplotype of the mouse MHC. Genomics. 1994 Sep 1;23(1):168-77
J:32563 Khambata S, et al., Ea recombinational hot spot in the mouse major histocompatibility complex maps to the fourth intron of the Ea gene. Genome Res. 1996 Mar;6(3):195-201
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory