D17Rua2-pA, D17Rua2-pB Primer Detail MGI Mouse MGI:789

D17Rua2-pA, D17Rua2-pB Primer Detail

Name

D17Rua2-pA, D17Rua2-pB
Primer 1 Sequence

CTTGCCCTTCTAAGACCTAA
Primer 2 Sequence

ACTGTATAGACTCAAGTCAG
ID

MGI:789
Region Covered

intron 2 of H2-Ea
Product Size

170bp

H2-Ea	histocompatibility 2, class II antigen E alpha
D17Rua2	DNA segment, Chr 17, Rutgers University 2

J:20144 Heine D, et al., Genomics. 1994 Sep 1;23(1):168-77

Gene	Allele	Fragments	Strains
D17Rua2	a	largest	A.SW-H2^s/Sn
	b	larger	B10.K-H2^k
	c	smaller	B10.D2-Hc⁰ H2^d H2-T18^c/oSnJ
	p	smallest	C3.NB-H2^p, P/J

J:32563 Khambata S, et al., Genome Res. 1996 Mar;6(3):195-201

Gene	Allele	Fragments	Strains
D17Rua2	a	not given	B10.F-H2^pb1/(13R)J
	c	not given	B10.S-H2^t4/(9R)/J, C57BL/10
	d	not given	A.TL-H2^t1

J:20144 Heine D, et al., Analysis of recombinational hot spots associated with the p haplotype of the mouse MHC. Genomics. 1994 Sep 1;23(1):168-77

J:32563 Khambata S, et al., Ea recombinational hot spot in the mouse major histocompatibility complex maps to the fourth intron of the Ea gene. Genome Res. 1996 Mar;6(3):195-201

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/23/2024 MGI 6.23