About   Help   FAQ
D3Nds11-pB, D3Nds11-pC Primer Detail
Primers
  • Name
    D3Nds11-pB, D3Nds11-pC
  • Primer 1 Sequence
    CGCTTCTAACTTGCTGAAAGGAA
  • Primer 2 Sequence
    TGTGAAAATACACAGGCTGCAGA
  • ID
    MGI:7781
Genes
D3Nds11 DNA segment, Chr 3, Nuffield Department of Surgery 11
Fcgr1 Fc receptor, IgG, high affinity I
Polymorphisms
J:29073 Ikegami H, et al., J Clin Invest. 1995 Oct;96(4):1936-42
Endonuclease Gene Allele Fragments Strains
D3Nds11 b 0.099kb ABH, C57BL/6J, NOD
d 0.103kb A/J, ABL, AKR/J, B6.PL-Thy1a, BALB/c, C3H/HeJ, C57BL/10SnJ, C57BR/cdJ, C57L/J, CAST/EiJ, CBA/J, DBA/2J, ICR, M. spretus/Crc, MRL/MpJ, MRL/MpJ-Faslpr/J, NON, NZB/BlNJ, NZW/LacJ, PL/J, SWR/J
References
J:29073 Ikegami H, et al., Identification of a new susceptibility locus for insulin-dependent diabetes mellitus by ancestral haplotype congenic mapping. J Clin Invest. 1995 Oct;96(4):1936-42
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory