About   Help   FAQ
T1 Primer Detail
Primers
  • Name
    T1
  • Primer 1 Sequence
    ACATGGTAATTTATGGGCAA
  • Primer 2 Sequence
    CTGGATACCTGCAATAGTAGA
  • ID
    MGI:735
Genes
D12Nds2 DNA segment, Chr 12, Nuffield Department of Surgery 2
Igh-V immunoglobulin heavy chain variable region
Polymorphisms
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D12Nds2 a 193bp A/J
b 195bp C57BL/6J, NOD/MrkTac, SPRET/EiJ
c 178bp C3H/HeJ
d 162bp DBA/2J
e 155bp B6.Cg-Lepob/+
f 159bp CAST/EiJ
g 165bp BALB/cJ, LP/J
h 170bp AKR/J
i 183bp NON/ShiLt
J:20788 Alonso S, et al., Mouse Genome. 1994;92(3):508-10
Endonuclease Gene Allele Fragments Strains
D12Nds2 m not given M. m. musculus
o not given (SI/Col x M. spretus)F1 x SI/Col or SI/Col x M. m. musculus)F1 x SI/Col
s not given M. spretus
J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4
Endonuclease Gene Allele Fragments Strains
D12Nds2 a smaller AKR/J
b largest C57BL/J
l smallest LG/J
s larger SM/J
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D12Nds2 a 166bp 129X1/Sv
f 158, 166, 172bp CD-1
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D12Nds2 c 172bp C3HeB/FeJLe
f larger FVB/N
References
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:20788 Alonso S, et al., Genetic map of Igh-C distal region on murine Chromosome 12. Mouse Genome. 1994;92(3):508-10
J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory