T1 Primer Detail MGI Mouse MGI:735

T1 Primer Detail

Name

T1
Primer 1 Sequence

ACATGGTAATTTATGGGCAA
Primer 2 Sequence

CTGGATACCTGCAATAGTAGA
ID

MGI:735

D12Nds2	DNA segment, Chr 12, Nuffield Department of Surgery 2
Igh-V	immunoglobulin heavy chain variable region

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D12Nds2	a	193bp	A/J
	b	195bp	C57BL/6J, NOD/MrkTac, SPRET/EiJ
	c	178bp	C3H/HeJ
	d	162bp	DBA/2J
	e	155bp	B6.Cg-Lep^ob/+
	f	159bp	CAST/EiJ
	g	165bp	BALB/cJ, LP/J
	h	170bp	AKR/J
	i	183bp	NON/ShiLt

J:20788 Alonso S, et al., Mouse Genome. 1994;92(3):508-10

Gene	Allele	Fragments	Strains
D12Nds2	m	not given	M. m. musculus
	o	not given	(SI/Col x M. spretus)F1 x SI/Col or SI/Col x M. m. musculus)F1 x SI/Col
	s	not given	M. spretus

J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4

Gene	Allele	Fragments	Strains
D12Nds2	a	smaller	AKR/J
	b	largest	C57BL/J
	l	smallest	LG/J
	s	larger	SM/J

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D12Nds2	a	166bp	129X1/Sv
Not Specified	D12Nds2	f	158, 166, 172bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D12Nds2	c	172bp	C3HeB/FeJLe
	D12Nds2	f	larger	FVB/N

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:20788 Alonso S, et al., Genetic map of Igh-C distal region on murine Chromosome 12. Mouse Genome. 1994;92(3):508-10

J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24